Williams 82 Transposable Element Database
The SoyTE database provides resources and information related to transposable elements (TEs) in the soybean genome. Using a combination of structure-based and homology-based approaches, a total of 32,552 retrotransposons (Class I) and 6,029 DNA transposons (Class II) with clear boundaries and insertion sites were structurally annotated and categorized. These TE sequences have been anchored in and integrated with the soybean physical and genetic maps, and are browsable and visualizable at any scale in the sequences of the 20 soybean chromosomes.
SoyTEdb: a comprehensive database of transposable elements in the soybean genome
Jianchang Du, David Grant, Zhixi Tian, Rex T Nelson, Liucun Zhu, Randy C Shoemaker and Jianxin Ma
BMC Genomics (2010) 11:113 doi:10.1186/1471-2164-11-113
Table of Contents
- Element Ontology
- Element Map Data
- Element BLAST Search
- Element Search and Retrieval
- Bulk Download
Repetitive Element Categories
Browse Repetitive Elements
Click on a green value to retrieve the records for TEs in that category.
- Class I
- Subclass I
- Order LINE
- Superfamily L1
- Superfamily Ukn
- Order LTR
- Class II
Transposable Element Map Position Data
Visualize TEs in the context of the soybean genetic map
Clicking on a chromosome or linkage
group below will show the genetic map with each class of transposable element in a separate column. The
Feature Options at the bottom of the page determines which TE classes are
shown. Similarly the Display Options can be used to alter the map's size and other display attributes.
Visualize TEs in the context of the soybean sequence map
Click on a chromosome or linkage
group below to show the genomic sequence along with all classes of transposable elements. Specific classes
of TEs can be also be shown separately using the check boxes at the bottom of the page.
Transposable Element BLAST Search
BLAST your sequences against the TE database
Clicking on the green link below will open the SoyBase BLAST page with the G. max transposable elements already selected as the target database.
BLAST TE Database
Search and Retrieve TE sequences
Search for TE sequences based on region
Search for a transposable element by name
|
|
Choose a chromosome to retrieve all TEs
|
Chromosomal Region Search
To download All Transposable Elements as a FASTA file click the button below
>name=RLG_Gmr164_Gm1-1 Reference=Du et al. 2010 BMC Genomics 2010, 11:113 Class=I SubClass=I Order=LTR Super_Family=Gypsy Family=Gmr164 Description=INTACT Chromosome=Gm01:62682..65118
TGAAAATATCTAGCAATTTACATAATATGAAACATGCCCAAATGAATGAGTTTTTGAAGTATATAATCAAAGAAGTCAAC
CTTCTTCATGAATAACATCATTGACACTCGTCCTATAGCAAAAGTCTTCGAAAACAAATAATGTTTATCCAGTTGCTGTT
GCCGTGTGTTCAAATGATTTCCAATATAAATACGCTACCAACATCATTTCTCTTTTTTTCCCCAATAAGTAAAAAAGGAA
TATTATGAACAATTCAAAATTGAAAATATAAATAAAAATATGTAAACAGGGATAAAAGTATGCAGGAGAAAGAGATTATA
ATTGGCAAGGAACTGACTGTGAACAGGTAGACAAATAATATAGAACATTACCCACATCCATTATTCATACCATCATCTCT
CTCTTGCTTCTTCTGCTTTTCCTTTCGTGTGGACTTCACCTGGACAGCTATATCAAGAGATGCAAAATATTGACTAAAAG
AATGAAATAGGGAAGCAAAAGTTTGCAGTCTCATCAAATAAAAGTGAACAATCAGTACAATGGATATATTATAAAATGAT
AGAAGTCCTTTTTTAATGTAAAAATACGTAAATGGGTTTGGTGCACAAAGCAGTGGTATAATTTTATGATGCCTAATACC
AGGTCCCATGCTCTCACTGTCTGGATTATTGGAGGCGTGCCCCCAGTTTCCCTTTCCTCTATGTTCTCCAAGTATAATGT
ATCCTGCATCAAATTTGATGATGATGACTGATGAAGTTTGAATGAATATTAGGTGGAGGGGAAGAAGATTTTAAAATGCT
TTGCAAAATGAATATTGAAATGGATGTAAGTCTACATATTTTATTTCTGGGCTTCTCTGTTTTTCAAATCTGTTTGTGAT
ATATGCAAACAGGGATAAAAGTATGCAGGAGAAAGCA
To download a Summary of all Transposable Elements as a tab delimited file click the button below
Element Name Reference Class SubClass Order Super Family Family Description Chromosome Unanchored Scaffold Start Position End Position
RLG_Gmr164_Gm1-1 Du et al. 2010 BMC Genomics 2010, 11:113 I I LTR Gypsy INTACT Gm01 62682 65118
DHH_uuu_Gm1-1 Du et al. 2010 BMC Genomics 2010, 11:113 II II Helitron Helitron Gm01 103518 115895