| Locus Type: | SSR |
Maps Containing Satt675
Genomic Sequence Information for Satt675
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
| Gm03 | 6923174 | 6923224 | (TTTA)3(TTA)14* | Wm82 | yes | Glyma 1.0 |
| Gm03 | 6771140 | 6771276 | (TTTA)3(TTA)14* | Wm82 | yes | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with Satt675
Amplification Info for Satt675
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | Satt675 |
| Primer1 | GCGCTATTTCCGTCCTATTATCATTTTCGTC |
| Primer2 | GCGTCTAACACGTATTTATTATTGGTCAATT |
| Motif | (TTTA)3(TTA)14* |
|    |    |
| Name | BARCSOYSSR_03_0357 |
| Primer1 | GCGCTATTTCCGTCCTATTATCATTTTCGTC |
| Primer2 | GCGTCTAACACGTATTTATTATTGGTCAATT |
| Motif | (TTTA)3(TTA)14* |
|    |    |
Information Providers
| Song, Qijian and Cregan, Perry |
References for Satt675