SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt592
Map NamePosition
GmComposite2003_O 100.37
GmConsensus40_O 91.359


Genomic Sequence Information for Satt592
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm10 4298385942983897(TAT)13Wm82yesGlyma 1.0
Gm10 4350973243509966(TAT)13Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt592
Leaflet shape 6-20
Leaflet shape 7-15
Leaflet width 7-11
Plant height 18-2
Plant height 19-2
Pod maturity 14-2
Pod maturity 15-2
Reproductive stage length 8-2
Reproductive stage length 9-2
Root nodule number 4-1
Root nodule number, big 1-2
Root nodule number, big 1-5
Root nodule number, small plus Rhizobia 1-1
Root nodule number, small plus Rhizobia 1-2
Root nodule weight, dry 3-2
SCN 37-1
Seed Cys 4-1
Seed glycitein 13-3
Seed glycitein 3-3
Seed isoflavone 11-7
Seed length 4-3
Seed length 4-4
Seed length to thickness ratio 1-1
Seed length to thickness ratio 1-2
Seed length to width ratio 1-6
Seed length to width ratio 1-7
Seed Met 4-3
Seed Met plus Cys 2-1
Seed tocopherol, total 1-5
Seed tocopherol, total 2-4
Seed width 4-6


Amplification Info for Satt592
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt592
Primer1GCGAAGATTGGTCTTTTATGTCAAATG
Primer2GCGGAGGAATACAAGTCTCTATTCAA
Motif(TAT)13
    
NameBARCSOYSSR_10_1339
Primer1GCGAAGATTGGTCTTTTATGTCAAATG
Primer2GCGGAGGAATACAAGTCTCTATTCAA
Motif(TAT)13
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt592
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo