SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt527
Map NamePosition
GmComposite2003_L 70.36
GmConsensus40_L 61.491


Genomic Sequence Information for Satt527
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm19 4283522842835278(ATT)17Wm82yesGlyma 1.0
Gm19 4303691843037112(ATT)17Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt527
cqSeed weight-005
cqSeed weight-007
cqSeed weight-009
cqSeed weight-012
Leaflet width 3-3
Phytoph 13-1
Phytoph 15-1
Phytoph 9-6
Plant height 8-3
Pod maturity 8-3
Seed height 1-10
Seed length 1-10
Seed length 4-8
Seed oil 43-28
Seed phytate 2-2
Seed volume 1-7
Seed weight 34-7
Seed weight 35-7
Seed weight 36-7
Seed weight 5-1
Seed yield to Plant height ratio 2-5
Total growth duration 1-3


Amplification Info for Satt527
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt527
Primer1GCGGTTACATCTTGCAAACTAAATTAAC
Primer2GCGGAATTTTGCACATAAATTAATAACT
Motif(ATT)17
    
NameBARCSOYSSR_19_1214
Primer1GCGGTTACATCTTGCAAACTAAATTAAC
Primer2GCGGAATTTTGCACATAAATTAATAACT
Motif(ATT)17
    

References for Satt527
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo