| Locus Type: | SSR |
Maps Containing Satt519
Genomic Sequence Information for Satt519
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
|---|
| Gm11 | 13984459 | 13984515 | (TAA)19 | Wm82 | yes | Glyma 1.0 |
| scaffold_21 | 886568 | 886805 | (TAA)19 | Wm82 | yes | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82,
Noir 1,
Minsoy,
Archer,
Evans,
Peking,
Essex, and
PI 468916
QTLs Associated with Satt519
| Flooding yield index 1-2 |
| Flooding yield index 1-3 |
| Plant P 1-2 |
| Plant weight 1-2 |
| Reproductive stage length 8-1 |
| Root area 1-1 |
| Root area 1-3 |
| Root length, primary 1-1 |
| Root length, primary 1-2 |
| Root length, primary 3-1 |
| Root P 1-2 |
| Root to Shoot weight ratio 1-1 |
| Root weight 1-1 |
| Root weight 1-3 |
| Seed number 3-1 |
| Seed number 3-3 |
| Seed weight 20-1 |
| Seed weight 20-3 |
| Seed weight 20-4 |
| Shoot P 1-2 |
| Shoot weight 1-2 |
| Shoot weight 1-3 |
| Plant P, variable P 4-2 |
| Plant weight, dry, variable P 3-1 |
| Root P, variable P 3-1 |
| Root to Shoot weight ratio, variable P 3-1 |
| Root weight, dry, variable P 4-1 |
| Root weight, dry, variable P 4-3 |
| Seed weight per plant, variable P 7-1 |
| Seed weight per plant, variable P 7-3 |
| Seed weight per plant, variable P 7-4 |
| Seeds per plant, variable P 4-1 |
| Seeds per plant, variable P 4-3 |
| Shoot P, variable P 2-2 |
| Shoot weight, dry, variable P 6-2 |
| Shoot weight, dry, variable P 6-3 |
Amplification Info for Satt519
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | Satt519 |
| Primer1 | GGATTTCAAAGAATGAACACAGA |
| Primer2 | CCGCAAGGTTACGAACTGCTCGAA |
| Motif | (TAA)19 |
| | |
| Name | BARCSOYSSR_11_0688 |
| Primer1 | GGATTTCAAAGAATGAACACAGA |
| Primer2 | CCGCAAGGTTACGAACTGCTCGAA |
| Motif | (TAA)19 |
| | |
Information Providers
| Song, Qijian and Cregan, Perry |
References for Satt519
SoyBase
SoyBase transitions to NEW site on 10/1/2024
