SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt495
Map NamePosition
GmComposite2003_L 0
GmConsensus40_L 2.739


Genomic Sequence Information for Satt495
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm19 650674650685(TTTA)3Wm82yesGlyma 1.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt495
Chlorosis, leaflet UV-B induced 1-6
Chlorosis, leaflet UV-B induced 1-7
Leaflet length 8-6
Leaflet length 9-7
Leaflet shape 6-13
Leaflet shape, UV-B induced 1-11
Leaflet shape, UV-B induced 10-9
Leaflet width 8-7
Leaflet width 9-4
Petiole color, UV-B induced 1-8
Petiole color, UV-B induced 1-9
Plant damage, UV-B induced 1-7
Plant damage, UV-B induced 1-9
Pod maturity 24-3
Pod number 1-9
Seed Ala 1-5
Seed Gly 1-4
Seed linolenic 7-1
Seed oil 43-27
Seed Phe 1-6
Seed Ser 1-4
Seed Thr 1-5


Amplification Info for Satt495
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt495
Primer1TGCCGCGAGATTAATATAATTTGT
Primer2GTGCGGCAAGAAGTTGAAATAAAG
Motif(TTTA)3
    
NameBARCSOYSSR_19_0046
Primer1TGCCGCGAGATTAATATAATTTGT
Primer2GTGCGGCAAGAAGTTGAAATAAAG
Motif(TTTA)3
    

References for Satt495
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo