SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt489
Map NamePosition
GmComposite2003_C2 113.38
GmConsensus40_C2 103.217


Genomic Sequence Information for Satt489
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 2387434223874464(AAT)8(AAC)8aataaa(AAT)23Wm82yesGlyma 1.0
Gm06 2384850123848757(AAT)8(AAC)8aataaa(AAT)23Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt489
First flower 26-15
First flower 5-1
Lodging 8-2
P use efficiency 1-5
Phytoph 6-6
Plant height 10-1
Plant height 13-2
Plant height 23-2
Pod maturity 10-1
Reproductive stage length 4-2
Root weight, dry 3-3
Seed length 1-5
Seed oil 27-6
Seed oleic 3-1
Seed palmitic 4-1
Seed weight 34-15
Seed yield to weight ratio 3-2


Amplification Info for Satt489
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt489
Primer1GCGTGTGCTTGCTTCTCTTAGACTGACT
Primer2GCGTACTACTTACCCTGTTTGTCTAAAA
Motif(AAT)8(AAC)8aataaa(AAT)23
    
NameBARCSOYSSR_06_1129
Primer1GCGTGTGCTTGCTTCTCTTAGACTGACT
Primer2GCGTACTACTTACCCTGTTTGTCTAAAA
Motif(AAT)8(AAC)8aataaa(AAT)23
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt489
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo