SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt345
Map NamePosition
GmComposite2003_O 59.43
GmConsensus40_O 52.096


Genomic Sequence Information for Satt345
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm10 1217207012172150(ATT)27Wm82yesGlyma 1.0
Gm10 1235535312355600(ATT)27Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt345
Leaflet area 2-3
Leaflet chlorophyll 1-8
Net photosyn rate 1-1
Plant weight 2-1
Root length, primary 3-5
Root weight 3-1
SCN 38-4
Seed height to width ratio 1-3
Seed length to width ratio 2-1
Seed oil 43-33
Seed protein 42-1
Seed tocopherol, gamma 2-6
Seed weight 27-2
Seed weight 50-10
Seeds per plant 1-1
Shoot weight 3-1


Amplification Info for Satt345
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt345
Primer1CCCCTATTTCAAGAGAATAAGGAA
Primer2CCATGCTCTACATCTTCATCATC
Motif(ATT)27
    
NameBARCSOYSSR_10_0564
Primer1CCCCTATTTCAAGAGAATAAGGAA
Primer2CCATGCTCTACATCTTCATCATC
Motif(ATT)27
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt345
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo