SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt309
Map NamePosition
GmComposite2003_G 4.53
GmConsensus40_G 10.103


Genomic Sequence Information for Satt309
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm18 17363051736343(ATA)13Wm82yesGlyma 1.0
Gm18 17366921736832(ATA)13Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt309
First flower 21-4
Leaflet chlorophyll 1-2
Lodging 20-7
Plant height 23-3
Pod maturity 22-6
Root nodule weight, dry 2-2
SCN 14-2
SCN 23-3
SCN 24-2
SCN 25-2
SCN 26-3
SCN 28-1
SCN 28-3
SCN 30-1
SCN 30-2
SCN 32-1
SCN 33-1
SCN 33-3
SCN 33-5
SCN 36-3
SCN 36-4
SCN 36-5
SCN 38-2
SCN 39-3
SCN 41-1
SCN 41-2
SCN 41-3
SCN 47-1
SCN 48-3
SDS 6-2
SDS 7-2
Seed length 4-7
Seed length to width ratio 1-14
Seed oil 42-31
Seed protein 26-12
Seed protein 36-25
Seed set 5-40
Seed thickness 1-7
Seed width 4-8


Amplification Info for Satt309
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt309
Primer1GCGCCTTCAAATTGGCGTCTT
Primer2GCGCCTTAAATAAAACCCGAAACT
Motif(ATA)13
    
NameBARCSOYSSR_18_0102
Primer1GCGCCTTCAAATTGGCGTCTT
Primer2GCGCCTTAAATAAAACCCGAAACT
Motif(ATA)13
    

References for Satt309
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo