SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt302
Map NamePosition
GmComposite2003_H 81.04
GmConsensus40_H 78.947


Genomic Sequence Information for Satt302
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm12 3510808935108142(ATA)13aag(TAA)4Wm82yesGlyma 1.0
Gm12 3508285235083099(ATA)13aag(TAA)4Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt302
Canopy wilt 2-4
Corn earworm 7-2
Drought index 1-3
Plant height 36-1
Pod maturity 30-1
Pubescence density 2-14
Pubescence density 2-8
Pubescence density 3-2
Pubescence length 1-2
Root area development 1-1
Root area development 1-2
Root diameter 1-3
Root length 1-3
Root length development 1-1
Root length development 1-2
Seed agglutinin 3-2
Seed daidzein 13-13
Seed genistein 4-2
Seed glycitein 4-4
Seed oil 37-5
Seed protein 33-1
Seed weight 13-8
Seed weight 34-4
Seed weight 35-4
Seed weight 36-4
Seed weight 41-1
Seed weight 50-15


Amplification Info for Satt302
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt302
Primer1GCGAACTGTAGTTTACTAAAAATAAGTG
Primer2GCGGACTGAATTAATATTGGTGTTGAATT
Motif(ATA)13aag(TAA)4
    
NameBARCSOYSSR_12_1142
Primer1GCGAACTGTAGTTTACTAAAAATAAGTG
Primer2GCGGACTGAATTAATATTGGTGTTGAATT
Motif(ATA)13aag(TAA)4
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt302
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo