| Locus Type: | SSR |
Maps Containing Satt296
Genomic Sequence Information for Satt296
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
| Gm02 | 12975935 | 12975997 | (ATA)21 | Wm82 | yes | Glyma 1.0 |
| Gm02 | 13335767 | 13335951 | (ATA)21 | Wm82 | yes | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with Satt296
Amplification Info for Satt296
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | Satt296 |
| Primer1 | GCCCCACAACCAGAAACAC |
| Primer2 | GAAATTTGGCGACTAAAAACTGC |
| Motif | (ATA)21 |
|    |    |
| Name | BARCSOYSSR_02_0677 |
| Primer1 | GCCCCACAACCAGAAACAC |
| Primer2 | GAAATTTGGCGACTAAAAACTGC |
| Motif | (ATA)21 |
|    |    |
Information Providers
| Song, Qijian and Cregan, Perry |
References for Satt296