Locus Type: | SSR |
Maps Containing Satt286
Genomic Sequence Information for Satt286
Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
Gm06 | 16171860 | 16171913 | (ATT)18 | Wm82 | yes | Glyma 1.0 |
Gm06 | 16221044 | 16221254 | (ATT)18 | Wm82 | yes | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with Satt286
First flower 26-4 |
Internode length 2-2 |
Internode length 2-4 |
Node number 7-2 |
Node number 7-3 |
Photoperiod insensitivity 2-1 |
Pod maturity, beginning 2-1 |
Pod, beginning 2-1 |
R/V photo-thermal sensitivity 1-1 |
Root area 3-1 |
Root area, coarse 1-1 |
Root area, fine plus Rhizobia 1-1 |
Root area, medium 1-1 |
Root length plus Rhizobia 1-1 |
Root length, coarse 1-1 |
Root length, fine plus Rhizobia 1-1 |
Root length, medium 1-1 |
Root nodule number, big 1-1 |
Root nodule number, big 1-4 |
Root nodule weight, dry 3-1 |
Root volume 2-1 |
Root volume, coarse 1-1 |
Root volume, fine plus Rhizobia 1-1 |
Root volume, medium 1-1 |
Root weight, dry 4-1 |
Seed glycinin 2-5 |
Seed glycinin plus beta-conglycinin 1-6 |
Seed protein 36-7 |
Seed tocopherol, gamma 1-3 |
Seed tocopherol, gamma 2-3 |
Seed tocopherol, total 1-2 |
Seed tocopherol, total 2-2 |
Seed yield 22-12 |
Shoot weight, dry 6-1 |
Somatic embryogenesis 1-2 |
Amplification Info for Satt286
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
Name | Satt286 |
Primer1 | GCGGCGTTAATTTATGCCGGAAA |
Primer2 | GCGTTTGGTCTAGAATAGTTCTCA |
Motif | (ATT)18 |
   |    |
Name | BARCSOYSSR_06_0863 |
Primer1 | GCGGCGTTAATTTATGCCGGAAA |
Primer2 | GCGTTTGGTCTAGAATAGTTCTCA |
Motif | (ATT)18 |
   |    |
Information Providers
Song, Qijian and Cregan, Perry |
References for Satt286