SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt281
Map NamePosition
GmComposite2003_C2 40.29
GmConsensus40_C2 38.898


Genomic Sequence Information for Satt281
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 65240746524146(ATA)20(ATAC)4*Wm82yesGlyma 1.0
Gm06 65292706529452(ATA)20(ATAC)4*Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt281
cqSeed protein-007
cqSeed weight-013
Plant weight 2-2
Rhizoc root and hypocot rot 1-1a
Rhizoc root and hypocot rot 1-1b
Root nodule number, big 1-1
Root nodule number, big 1-4
Root nodule weight, dry 3-1
Seed glycitein 7-1
Seed protein 30-5
Seed weight 45-1
Seed yield 11-1
Shoot weight 3-2
Shoot weight, dry 6-1
Stem strength, main 1-7


Amplification Info for Satt281
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt281
Primer1AAGCTCCACATGCAGTTCAAAAC
Primer2TGCATGGCACGAGAAAGAAGTA
Motif(ATA)20(ATAC)4*
    
NameBARCSOYSSR_06_0362
Primer1AAGCTCCACATGCAGTTCAAAAC
Primer2TGCATGGCACGAGAAAGAAGTA
Motif(ATA)20(ATAC)4*
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt281
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo