SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt252
Map NamePosition
GmComposite2003_F 16.08
GmConsensus40_F 22.623


Genomic Sequence Information for Satt252
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm13 53765645376632(TAT)23Wm82yesGlyma 1.0
Gm13 1645498616455201(TAT)23Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt252
Al tolerance 2-1
Flood tolerance 3-2
Leaflet P 1-1
mqSeed Oil-015
Node number 2-3
Phytoph 1-1
Phytoph 2-1
Phytoph 3-1
Phytoph 4-1
Pod wall to Pod weight ratio 1-2
Seed Ala 1-4
Seed Cys 1-1
Seed Cys 2-3
Seed Met 1-1
Seed Met 2-1
Seed Met plus Cys 1-2
Seed oil 24-4
Seed set, 4 per pod 1-5
Seed stearic 6-3
Seed Val 1-3
Seed weight 37-2
Seed weight 46-1
Shoot fresh to dry weight ratio 1-3


Amplification Info for Satt252
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt252
Primer1GCGAATTTGGATTAATTAAATTTATG
Primer2GCGCTCGGTCCTCTCAAATAAGGTCTC
Motif(TAT)23
    
NameBARCSOYSSR_13_0272
Primer1GCGAATTTGGATTAATTAAATTTATG
Primer2GCGCTCGGTCCTCTCAAATAAGGTCTC
Motif(TAT)23
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt252
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo