SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt243
Map NamePosition
GmComposite2003_O 119.5
GmConsensus40_O 107.308


Genomic Sequence Information for Satt243
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm10 4608833246088382(TAT)17Wm82yesGlyma 1.0
Gm10 4665786346658059(TAT)17Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt243
First flower 24-4
Leaflet length 7-12
Leaflet shape 6-21
Leaflet shape 7-16
Lodging 20-6
Phomopsis seed decay 3-2
Phomopsis seed decay 4-2
Plant height 23-4
Pod dehiscence 3-8
Pod maturity 32-3
Pod maturity 33-3
Pod number 8-3
Reproductive stage length 8-2
Sclero 10-5
Sclero 3-19
Sclero 5-16
Sclero 6-13
Seed set 5-21
Seed set 5-22
Stem weight, dry 1-3


Amplification Info for Satt243
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt243
Primer1GCGCATTGCACATTAGGTTTTCTGTT
Primer2GCGGTAAGATCACGCCATTATTTAAGA
Motif(TAT)17
    
NameBARCSOYSSR_10_1517
Primer1GCGCATTGCACATTAGGTTTTCTGTT
Primer2GCGGTAAGATCACGCCATTATTTAAGA
Motif(TAT)17
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt243
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo