SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt202
Map NamePosition
GmComposite2003_C2 126.23
GmConsensus40_C2 114.183


Genomic Sequence Information for Satt202
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 4782051747820561(TTA)15Wm82yesGlyma 1.0
Gm06 4844150448441803(TTA)15Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt202
Al tolerance 2-2
Al tolerance 2-3
Canopy wilt 3-12
Photoperiod insensitivity 5-1
Plant height 29-2
Pod maturity 21-1
Pod wall width 1-2
Pod wall width 1-3
Root length, primary 2-1
SCN 17-3
SCN 20-2
SCN 42-3
SDS 16-5
Seed oil 43-3
Seed oil 43-6
Seed oil plus protein 1-2
Seed protein 24-1
Seed protein 36-4
Seed protein 36-7
Seed protein 36-8
Seed set 5-14
Seed weight 36-2
Seed weight 49-4
Seed weight 49-5


Amplification Info for Satt202
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt202
Primer1GGAATGCATGAGTATTAACCTCTTAT
Primer2GGGCTAACGAACATGTAACTTATCAAC
Motif(TTA)15
    
NameBARCSOYSSR_06_1680
Primer1GGAATGCATGAGTATTAACCTCTTAT
Primer2GGGCTAACGAACATGTAACTTATCAAC
Motif(TTA)15
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt202
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo