| Locus Type: | SSR |
Maps Containing Satt183
Genomic Sequence Information for Satt183
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
| Gm16 | 25103030 | 25103068 | (TTA)13 | Wm82 | yes | Glyma 1.0 |
| Gm16 | 25456677 | 25456915 | (TTA)13 | Wm82 | yes | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with Satt183
Amplification Info for Satt183
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | Satt183 |
| Primer1 | TAGGTCCCAGAATTTCATTG |
| Primer2 | CACCAACCAGCACAAAA |
| Motif | (TTA)13 |
|    |    |
| Name | BARCSOYSSR_16_0752 |
| Primer1 | TAGGTCCCAGAATTTCATTG |
| Primer2 | CACCAACCAGCACAAAA |
| Motif | (TTA)13 |
|    |    |
References for Satt183