SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Locus Type:  SSR


Map NamePosition
GmComposite2003_C2 113.95
GmConsensus40_C2 102.941


ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 3066841630668454(TTA)13Wm82yesGlyma 1.0
Gm06 3149062231490787(TTA)13Wm82yesGlyma 2.0


First flower 18-1
First flower 20-1
First flower 22-2
First flower 26-18
Flood tolerance 4-1
Hypocotyl weight 1-3
Leaflet shape 8-5
Leaflet shape 9-4
Leaflet shape, UV-B induced 10-2
Lodging 27-3
Node number 4-2
Phomopsis seed decay 3-1
Phomopsis seed decay 4-1
Phytoph 6-6
Plant height 29-1
Plant height 30-1
Plant height 35-2
Pod maturity 25-1
Pod maturity 28-4
Pod maturity 32-2
Pod maturity 33-2
Pod maturity 34-2
Pod number 5-1
Pod number 7-1
Pods per node 3-1
Rag 4-1
Seed coat color 1-3
Seed oil 31-2
Seed oil 33-1
Seed oil 38-2
Seed oligosaccharide 2-2
Seed protein 28-1
Seed protein 29-1
Seed protein 35-2
Seed set 4-1
Seed weight 31-1
Seed weight 34-2
Seed weight 35-2
Seed weight 40-3
Seed yield 28-4
Seed, beginning 3-1


NameSatt100
Primer1ACCTCATTTTGGCATAAA
Primer2TTGGAAAACAAGTAATAATAACA
Motif(TTA)13
    
NameBARCSOYSSR_06_1202
Primer1ACCTCATTTTGGCATAAA
Primer2TTGGAAAACAAGTAATAATAACA
Motif(TTA)13
    


Song, Qijian and Cregan, Perry

Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo