| Locus Type: | SSR |
Maps Containing Sat_420
Genomic Sequence Information for Sat_420
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
| Gm20 | 41816838 | 41816875 | (TA)19 | Wm82 | yes | Glyma 1.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with Sat_420
Amplification Info for Sat_420
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | Sat_420 |
| Primer1 | GCGGATGGAGCCAACA |
| Primer2 | GCGTGTAGCCCTAGAAAGTT |
| Motif | (TA)19 |
|    |    |
| Name | BARCSOYSSR_20_1271 |
| Primer1 | GCGGATGGAGCCAACA |
| Primer2 | GCGTGTAGCCCTAGAAAGTT |
| Motif | (TA)19 |
|    |    |
References for Sat_420