BARCSOYSSR_20_0819

Locus Type: SSR

Maps Containing BARCSOYSSR_20_0819

Map Name	Position
GmComposite2003_I	50.72

Some of the BARCSOYSSR loci were previously genetically mapped under a different name. In these cases the SoyBase genetic maps use the original name which will be highlighted on the maps.

Genomic Sequence Information for BARCSOYSSR_20_0819

Chromosome	Start Pos	End Pos	Motif	Derived From	Polymorphic*	Assembly Version
Gm20	34510335	34510378	(TA)22	Wm82	yes	Glyma 1.0
Gm20	35649834	35649877	(TA)22	Wm82	yes	Glyma 2.0

*Polymorphic in the following germplasms:
Williams 82, Noir 1, Minsoy, Archer, Evans, Peking, Essex, and PI 468916

QTLs Associated with BARCSOYSSR_20_0819

Seed Cys 3-7

Seed Met 3-7

Amplification Info for BARCSOYSSR_20_0819

More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.

Name	BARCSOYSSR_20_0819
Primer1	CTCGTCACTCGATCCCTTTT
Primer2	GCCCAATACAAAAGAAAAGAAGAA
Motif	(TA)22

References for BARCSOYSSR_20_0819

Song et al. 2010a Abundance of SSR Motifs and Development of Candidate Polymorphic SSR Markers (BARCSOYSSR_1.0) in Soybean Crop Sci. 2010 50:1950-1960

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain