BARCSOYSSR_19_1243

Locus Type: SSR

Maps Containing BARCSOYSSR_19_1243

Map Name	Position
GmComposite2003_L	76.82

Some of the BARCSOYSSR loci were previously genetically mapped under a different name. In these cases the SoyBase genetic maps use the original name which will be highlighted on the maps.

Genomic Sequence Information for BARCSOYSSR_19_1243

Chromosome	Start Pos	End Pos	Motif	Derived From	Polymorphic*	Assembly Version
Gm19	43330107	43330174	(TA)34	Wm82	unknown	Glyma 1.0
Gm19	43533689	43533756	(TA)34	Wm82	unknown	Glyma 2.0

*Polymorphic in the following germplasms:
Williams 82, Noir 1, Minsoy, Archer, Evans, Peking, Essex, and PI 468916

QTLs Associated with BARCSOYSSR_19_1243

Phytoph 15-1

Phytoph 11-9

Amplification Info for BARCSOYSSR_19_1243

More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.

Name	BARCSOYSSR_19_1243
Primer1	CCACGGTATAACTTTCAAGCA
Primer2	TGACATTGCTTCATCTTTGTTCA
Motif	(TA)34

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain