BARCSOYSSR_18_1710

Locus Type: SSR

Maps Containing BARCSOYSSR_18_1710

Map Name	Position
GmComposite2003_G	95.2

Some of the BARCSOYSSR loci were previously genetically mapped under a different name. In these cases the SoyBase genetic maps use the original name which will be highlighted on the maps.

Genomic Sequence Information for BARCSOYSSR_18_1710

Chromosome	Start Pos	End Pos	Motif	Derived From	Polymorphic*	Assembly Version
Gm18	58174639	58174706	(TA)34	Wm82	unknown	Glyma 1.0
Gm18	53902882	53902949	(TA)34	Wm82	unknown	Glyma 2.0

*Polymorphic in the following germplasms:
Williams 82, Noir 1, Minsoy, Archer, Evans, Peking, Essex, and PI 468916

QTLs Associated with BARCSOYSSR_18_1710

Phytoph 15-4

Amplification Info for BARCSOYSSR_18_1710

More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.

Name	BARCSOYSSR_18_1710
Primer1	TCTTGGGTCGTTGAGAGGTT
Primer2	ACCCACATGGCAATCACTTT
Motif	(TA)34

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain