| Locus Type: | SSR |
Maps Containing BARCSOYSSR_18_1699
Some of the BARCSOYSSR loci were previously genetically mapped under
a different name. In these cases the SoyBase genetic maps use the
original name which will be highlighted on the maps.
Genomic Sequence Information for BARCSOYSSR_18_1699
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
| Gm18 | 58058791 | 58058834 | (AT)22 | Wm82 | unknown | Glyma 1.0 |
| Gm18 | 53789166 | 53789209 | (AT)22 | Wm82 | unknown | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82, 
Noir 1, 
Minsoy, 
Archer, 
Evans, 
Peking, 
Essex, and  
PI 468916
QTLs Associated with BARCSOYSSR_18_1699
Amplification Info for BARCSOYSSR_18_1699
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | BARCSOYSSR_18_1699 |
| Primer1 | TCGTTATATCCCGAACCGAA |
| Primer2 | CTGCTTTGTCCCAATCCACT |
| Motif | (AT)22 |
|    |    |