SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing BARCSOYSSR_17_0844
Map NamePosition
GmComposite2003_D2 79.43

Some of the BARCSOYSSR loci were previously genetically mapped under a different name. In these cases the SoyBase genetic maps use the original name which will be highlighted on the maps.

Genomic Sequence Information for BARCSOYSSR_17_0844
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm17 1491278614912855(AT)35Wm82yesGlyma 1.0
Gm17 1467594214676011(AT)35Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with BARCSOYSSR_17_0844
Seed Cys 3-5
Seed Met 3-5
Seed yield 31-3


Amplification Info for BARCSOYSSR_17_0844
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameBARCSOYSSR_17_0844
Primer1CGAGTGTAAAATGAAATCTGCC
Primer2TGTTACATGTATTCAAAAGACTAGGAA
Motif(AT)35
    

References for BARCSOYSSR_17_0844
Song et al. 2010a Abundance of SSR Motifs and Development of Candidate Polymorphic SSR Markers (BARCSOYSSR_1.0) in Soybean Crop Sci. 2010 50:1950-1960






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo