SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  potential_SSR


Genomic Sequence Information for BARCSOYSSR_09_1171
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm09 3711101337111042(TC)15Wm82unknownGlyma 1.0
Gm09 3968490839684937(TC)15Wm82unknownGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with BARCSOYSSR_09_1171
Seed oil 39-13
Seed protein 37-10
Seed yield 31-10


Amplification Info for BARCSOYSSR_09_1171
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameBARCSOYSSR_09_1171
Primer1AGTCTACACCCCAACAACGC
Primer2CAAAGTTAGACCACCCCCAA
Motif(TC)15
    


Information Providers
Song, Qijian and Cregan, Perry







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo