SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g37571): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g37571): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g37571

Feature Type:gene_model
Chromosome:Gm20
Start:45430275
stop:45432783
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05210AT Annotation by Michelle Graham. TAIR10: nucleotide repair protein, putative | chr3:1479591-1481823 FORWARD LENGTH=410 SoyBaseE_val: 7.00E-104ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0000956GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear-transcribed mRNA catabolic process SoyBaseN/AISS
GO:0006281GO-bp Annotation by Michelle Graham. GO Biological Process: DNA repair SoyBaseN/AISS
GO:0006284GO-bp Annotation by Michelle Graham. GO Biological Process: base-excision repair SoyBaseN/AISS
GO:0006294GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide-excision repair, preincision complex assembly SoyBaseN/AISS
GO:0010213GO-bp Annotation by Michelle Graham. GO Biological Process: non-photoreactive DNA repair SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003684GO-mf Annotation by Michelle Graham. GO Molecular Function: damaged DNA binding SoyBaseN/AISS
GO:0004519GO-mf Annotation by Michelle Graham. GO Molecular Function: endonuclease activity SoyBaseN/AISS
GO:0017108GO-mf Annotation by Michelle Graham. GO Molecular Function: 5'-flap endonuclease activity SoyBaseN/AISS
KOG2841 KOG Structure-specific endonuclease ERCC1-XPF, ERCC1 component JGI ISS
PTHR12749Panther EXCISION REPAIR CROSS-COMPLEMENTING 1 ERCC1 JGI ISS
PF03834PFAM Binding domain of DNA repair protein Ercc1 (rad10/Swi10) JGI ISS
UniRef100_G7I805UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA excision repair protein ERCC-1 n=1 Tax=Medicago truncatula RepID=G7I805_MEDTR SoyBaseE_val: 2.00E-135ISS
UniRef100_UPI000233DDA8UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233DDA8 related cluster n=1 Tax=unknown RepID=UPI000233DDA8 SoyBaseE_val: 1.00E-168ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g37571 not represented in the dataset

Glyma20g37571 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g29730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g232000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g37571.1   sequence type=CDS   gene model=Glyma20g37571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTAAAATATTCTCACTTCTTCCTCACACTCTCCTAGGATACGTATCCAGCCGTATCCGTGGAGTATCGAAAGGAAATCCCTTGCTAAAACACATTAGGAACGTTAGATGGGCATTTGCTGATGTTGTTTGTGACTACTTGCTTGGCCAAAGCTCCTGTGCTCTGTATCTCAGTCTTCGGTATCATCTTCTGCATCCAGACTACTTGTTTTATAGAATAAGGAAGTTGCAGAAGAATTTCAAGCTTCGTGTGGTTTTATGCCATGTTGGTGTGGAAGATGTAATAAAGCCTCTTCTTGAAGTTACAAAAACAGCTTTGCTTCATGACTGTACACTCCTATGTGGATGGAGCCTGGAGGAATGTGGCCGTTACTTGGAAACCATAAAACTAACACATGCCCTTACAACAGTCCGGCATGTTAACAAGACTGATGTAGTCACCCTCGGTACCACATTTGGGTATCTTTGTAACATTATGGGTGCATCTATGGAAGATCTAGCTCGTTGCCCTGGCATAGTAGGAGAGCGCAAGGTCAAGCGCTTGTTTGACACTTTTCATGAACCCTTCAAGCATGTGGAATCCAGCCGGCAAGCCATTCCAGAGACTTCTGTCCAGAACAAGCCAGCTAGTCCGAAGAAAGAACTTGAAGTTACTGTCAAATCTGCCCTTTCTGCAGCTTTTGCCAAATATTCTGGTAGAGTTGGAAAGAGGAAAAGCACTTCACAGGTGGAGGAAAAAGGAGAATCAATTATTTCCAAAGAATCAGAAGCTGAAACATAA

>Glyma20g37571.1   sequence type=predicted peptide   gene model=Glyma20g37571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKIFSLLPHTLLGYVSSRIRGVSKGNPLLKHIRNVRWAFADVVCDYLLGQSSCALYLSLRYHLLHPDYLFYRIRKLQKNFKLRVVLCHVGVEDVIKPLLEVTKTALLHDCTLLCGWSLEECGRYLETIKLTHALTTVRHVNKTDVVTLGTTFGYLCNIMGASMEDLARCPGIVGERKVKRLFDTFHEPFKHVESSRQAIPETSVQNKPASPKKELEVTVKSALSAAFAKYSGRVGKRKSTSQVEEKGESIISKESEAET*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo