Glyma20g35280 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g35280

Feature Type:	gene_model
Chromosome:	Gm20
Start:	43559061
stop:	43560774
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g35280

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G43700	AT	Annotation by Michelle Graham. TAIR10: AUX/IAA transcriptional regulator family protein \| chr5:17550465-17551206 FORWARD LENGTH=186	SoyBase	E_val: 6.00E-83	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006417	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of translation	SoyBase	N/A	ISS
GO:0007020	GO-bp	Annotation by Michelle Graham. GO Biological Process: microtubule nucleation	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009736	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
PF02309	PFAM	AUX/IAA family	JGI		ISS
UniRef100_I1NIA4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NIA4_SOYBN	SoyBase	E_val: 1.00E-140	ISS
UniRef100_P32294	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Auxin-induced protein 22B n=1 Tax=Vigna radiata var. radiata RepID=AX22B_VIGRR	SoyBase	E_val: 2.00E-98	ISS

Expression Patterns of Glyma20g35280

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g35280

Paralog	Evidence	Comments
Glyma10g32330	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g35280 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g210500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g35280

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g35280

Limit To All Plant Sequences

>Glyma20g35280.1   sequence type=CDS   gene model=Glyma20g35280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACACTACTGTGACATATCAAACTGATCTCAACCTCAAGGCAACAGAGCTTAGACTGGGGCTTCCAGGAACAGAAGAAAGTGAGGAGAAAACACTGTCTGCAGGTGCTAGAATTAACAACAAAAGACCTTTAACTGAAACCTCTGATGAGTGTGCTTCAAATGGTACTTCTAGTGCTCCACATGAGAAAACTGAAACAGCCCCTCCTGCCAAGACTAAGATAGTGGGGTGGCCACCAATCAGATCCTATAGGAAGAACAGCCTTCAGGAGAGTGAGGGTGCTGGAATTTATGTGAAAGTGAGCATGGATGGAGCCCCTTACCTCAGAAAGATTGACTTGAAGGTCTATGGAGGCTACACACAACTCCTCAAATCTCTAGAAAATATGTTCAAGTTGACCATAGGAGAGCATTCTGAAAAAGAAGGTTATAAGGGATCTGACTATGCACCTACATATGAAGACAAAGATGGTGACTGGATGTTAGTTGGAGATGTTCCATGGGACATGTTTGTGACTTCTTGCAGAAGGCTAAGAATCATGAAAGGATCAGAGGCAAGGGGTTTGGGTTGTGCTGTATGA

Predicted protein sequences of Glyma20g35280

Limit To All Plant Sequences

>Glyma20g35280.1   sequence type=predicted peptide   gene model=Glyma20g35280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENTTVTYQTDLNLKATELRLGLPGTEESEEKTLSAGARINNKRPLTETSDECASNGTSSAPHEKTETAPPAKTKIVGWPPIRSYRKNSLQESEGAGIYVKVSMDGAPYLRKIDLKVYGGYTQLLKSLENMFKLTIGEHSEKEGYKGSDYAPTYEDKDGDWMLVGDVPWDMFVTSCRRLRIMKGSEARGLGCAV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain