SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma20g34570

Feature Type:gene_model
Chromosome:Gm20
Start:42943921
stop:42945130
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G23240AT Annotation by Michelle Graham. TAIR10: ethylene response factor 1 | chr3:8295705-8296361 FORWARD LENGTH=218 SoyBaseE_val: 2.00E-71ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF00847PFAM AP2 domain JGI ISS
UniRef100_B9SZX0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ethylene-responsive transcription factor 1B, putative n=1 Tax=Ricinus communis RepID=B9SZX0_RICCO SoyBaseE_val: 1.00E-75ISS
UniRef100_I1NI29UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NI29_SOYBN SoyBaseE_val: 3.00E-156ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g33060 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g203700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g34570.1   sequence type=CDS   gene model=Glyma20g34570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATTCACCTTCCTCCTTCTTCAACTCACCCTCTTCCGATTTCTCCTCCGAATCTTCCTCTCCGGAAGCGTTCTCGTGGGAAGGGTACCTTCCCTTCAACGAGAACGACCCGGAGGAGATGCTTTTGTACGGCATGATTGCCGGCGCCACCACCGTGGATCACTCCTTCGAGAGGACGAGCTCGGAGGAGAGTGAGGCGGCCCGGAAGAAGAAGTCGTACAGAGGTGTGCGGCGGCGGCCGTGGGGGAAGTTCGCGGCGGAGATAAGGGACTCCACGCGTCACGGGATGAGGGTGTGGCTGGGAACATTCGACAGCGCCGAAGCCGCGGCTCTGGCTTACGACCAAGCCGCGTTCTCCATGCGCGGTTCGGCGGCGATTCTCAACTTCCCCGTGGAGATCGTCAGAGAGTCGCTTAAGGAGATGAACTATGCAAATGATTCCAACAACGAAGAAGGGTGCTCCCCTGTTGTGGCTCTGAAGAGGAAACACTCCTTGAGAAGGAAAATTAGCGTCAAGAAGAACAACAACAGCAAACTACAAAGTAGTACCGTAGACAATGCTGTCGTGTTTGAAGACCTTGGTCCTGATTACTTGGAACAGTTGCTGATGTCCTCTGATCATCATATTCCCACCACCTTCTGA

>Glyma20g34570.1   sequence type=predicted peptide   gene model=Glyma20g34570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDSPSSFFNSPSSDFSSESSSPEAFSWEGYLPFNENDPEEMLLYGMIAGATTVDHSFERTSSEESEAARKKKSYRGVRRRPWGKFAAEIRDSTRHGMRVWLGTFDSAEAAALAYDQAAFSMRGSAAILNFPVEIVRESLKEMNYANDSNNEEGCSPVVALKRKHSLRRKISVKKNNNSKLQSSTVDNAVVFEDLGPDYLEQLLMSSDHHIPTTF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo