SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g33380): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g33380): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g33380

Feature Type:gene_model
Chromosome:Gm20
Start:41970508
stop:41976153
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G58330AT Annotation by Michelle Graham. TAIR10: lactate/malate dehydrogenase family protein | chr5:23580010-23582287 REVERSE LENGTH=442 SoyBaseE_val: 0ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006108GO-bp Annotation by Michelle Graham. GO Biological Process: malate metabolic process SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0044262GO-bp Annotation by Michelle Graham. GO Biological Process: cellular carbohydrate metabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016615GO-mf Annotation by Michelle Graham. GO Molecular Function: malate dehydrogenase activity SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0046554GO-mf Annotation by Michelle Graham. GO Molecular Function: malate dehydrogenase (NADP+) activity SoyBaseN/AISS
KOG1496 KOG Malate dehydrogenase JGI ISS
PTHR23382Panther MALATE DEHYDROGENASE JGI ISS
PF00056PFAM lactate/malate dehydrogenase, NAD binding domain JGI ISS
PF02866PFAM lactate/malate dehydrogenase, alpha/beta C-terminal domain JGI ISS
UniRef100_O48902UniRef Annotation by Michelle Graham. Most informative UniRef hit: Malate dehydrogenase [NADP], chloroplastic n=1 Tax=Medicago sativa RepID=MDHP_MEDSA SoyBaseE_val: 0ISS
UniRef100_UPI000189DA4EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000189DA4E related cluster n=1 Tax=unknown RepID=UPI000189DA4E SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g33380 not represented in the dataset

Glyma20g33380 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g34150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g192200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g33380.2   sequence type=CDS   gene model=Glyma20g33380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGTGACACAGTTGAACCCCACTTGCTCAAAACCTCGTCTTCACTCATCTCAGCTCTCTTTTCTATCAAGGACTCTTCCTAGACATCGCCACTGCACTTTTGCGCCACTTCATAGAACTCAACAAGCTAGGATTTCCTGTTCTGTTGCACCAAATGAAGTGCAGGTGCCAACTGTGAAAACCCAGGATCCCAAGAGTAAGCCTGAGTGCTATGGTGTCTTCTGCCTTACCTATGATTTGAGGGCTGAAGAAGAGACAAGATCCTGGAAGAAATTAATTAACATTGCAGTCTCAGGTGCTGCTGGAATGATTGCAAACCATCTACTTTTCAAGCTTGCATCTGGTGAAGTTTTTGGTCCTGATCAACCTATTGCTCTCAAATTATTGGGATCAGAAAGGTCAATCCAAGCTCTTGAAGGTGTTGCAATGGAACTGGAGGACTCTTTGTTTCCTTTGTTGAGGGAGGTCAGTATTGGTATCGATCCTTATGAAGTGTTCCAAGATGCAGAATGGGCTTTGCTAATAGACTTGTTAGACATAAATGGGCAGATTTATGCAGCGCAGGGAAGAGCTTTAAATGCCGTTGCATCCCGCAATGTCAAAGTTATAGTAGTGGGAAACCCTTGCAATACAAATGCATTAATATGCTTGAAGAATGCTCCTAACATTCCTGCAAAAAATTTTCATGCTTTAACTCGTTTAGATGAGAACAGAGCAAAATGTCAGCTAGCCCTCAAGGCAGGTGTCTTCTATGATAAAGTGTCAAATGTGACAATATGGGGCAACCACTCAACTACTCAGGTCCCTGACTTCTTAAATGCTAGAATTGATGGTTTGCCAGTCAAAGAGGTGGTTAAGGATCATAAGTGGTTGGAGGAAGAGTTCACTGAAAAGGTTCAAAAGAGAGGTGGTGCGCTTATTCAAAAATGGGGAAGATCATCAGCTGCATCAACTTCTGTGTCAATTGTTGATGCCATAAGATCTTTAGTAACTCCTACTCCCGAGGGTGATTGGTTTTCTTCTGGTGTATATAGCAATGGAAATCCTTATGGAATAGCTGAAGGTATTGTTTTCAGTATGCCATGCCGATCAAAGGGTGATGGTGATTATGAACTTGTCAAGGATGTCATATTTGATGACTACCTCCGGCAGCGAATAGCTAAGACGGAAGCCGAGTTGTTGGCCGAGAAGAGATGTGTGGCTCACCTAACAGGCGAGGGAATTGCTGTTTGTGATCTACCTGGTGATACCATGCTCCCAGGAGAAATGTAA

>Glyma20g33380.2   sequence type=predicted peptide   gene model=Glyma20g33380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVTQLNPTCSKPRLHSSQLSFLSRTLPRHRHCTFAPLHRTQQARISCSVAPNEVQVPTVKTQDPKSKPECYGVFCLTYDLRAEEETRSWKKLINIAVSGAAGMIANHLLFKLASGEVFGPDQPIALKLLGSERSIQALEGVAMELEDSLFPLLREVSIGIDPYEVFQDAEWALLIDLLDINGQIYAAQGRALNAVASRNVKVIVVGNPCNTNALICLKNAPNIPAKNFHALTRLDENRAKCQLALKAGVFYDKVSNVTIWGNHSTTQVPDFLNARIDGLPVKEVVKDHKWLEEEFTEKVQKRGGALIQKWGRSSAASTSVSIVDAIRSLVTPTPEGDWFSSGVYSNGNPYGIAEGIVFSMPCRSKGDGDYELVKDVIFDDYLRQRIAKTEAELLAEKRCVAHLTGEGIAVCDLPGDTMLPGEM*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo