SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g32940): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g32940): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g32940

Feature Type:gene_model
Chromosome:Gm20
Start:41546228
stop:41549157
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03680AT Annotation by Michelle Graham. TAIR10: Duplicated homeodomain-like superfamily protein | chr5:957858-960760 FORWARD LENGTH=591 SoyBaseE_val: 1.00E-85ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0046621GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of organ growth SoyBaseN/AISS
GO:0048438GO-bp Annotation by Michelle Graham. GO Biological Process: floral whorl development SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048441GO-bp Annotation by Michelle Graham. GO Biological Process: petal development SoyBaseN/AISS
GO:0048442GO-bp Annotation by Michelle Graham. GO Biological Process: sepal development SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0048498GO-bp Annotation by Michelle Graham. GO Biological Process: establishment of petal orientation SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0090428GO-bp Annotation by Michelle Graham. GO Biological Process: perianth development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG4282 KOG Transcription factor GT-2 and related proteins, contains trihelix DNA-binding/SANT domain JGI ISS
UniRef100_B9SY13UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor, putative n=1 Tax=Ricinus communis RepID=B9SY13_RICCO SoyBaseE_val: 2.00E-128ISS
UniRef100_UPI000233DBBFUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233DBBF related cluster n=1 Tax=unknown RepID=UPI000233DBBF SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g32940 not represented in the dataset

Glyma20g32940 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g34610 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g188100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g32940.1   sequence type=CDS   gene model=Glyma20g32940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGATCCTTATGGGCTACCGGAGGATCTCCGGCGGCTTATACCAGCCAGAAGTACCCATTTGAACCCTTCAGACACACACCTAATTGAACCACTTTGTGTTCACCATGGTCTCAGTAGTGCTGTTGCTGCTGCTACTGCTAGTGCTACTCCACCCATCACCTATGACGCCAACATGGTTGGGGACGTTTTCTTCCCTCGTGGTTTCACTCATCACTTTGCTCATCACCATGACTATTCTTCTTCCTCTGGCGTAAACCCCGTTGCTACTACTGCTACTGCTACTGCTACTACTACTGTCTCGGATCATGCATTCTGCAGCATGGAAAGTGCAGAGAAAGGGTGGTTTGGGTTTGATTCCGGGAACAACAGGTGGCCTAGACAGGAGACCCTTTCTCTTCTAGAGATCAGATCTCGTCTTGATTCCAAGTTCAGAGAGAACAATCAGAAAGCACCCTTGTGGAATGAGATTTCTAGGATAATGGCTGAGGAATTTGGGTACCAAAGAAGTGGAAAGAAATGCAAAGAGAAATTTGAGAATTTGTACAAGTATTACAAGAAGACAAAAGAAGGTAAAGCTAGTAGACAAGATGGGAAGCACTACAGGTTCTTCAGGCAGCTAGAAGCAATATGTGGAGATCAAGCAAATAACACTCATGCTCATGCCTCAACTTCAGATAAAACCCATCGTGCTGGTGGAAACACTGCTGCTACTATTCAAAAACAAACCTTCACAACCAACCAAGACCACAATAATGGTGATTCTAACAATAACCCCAAATGCTCAGAGAGCCTCAGCATCTCAAATTCATCTCAATTCGAGACATCCTCATCAGAGAACAACGATGAGGATCTTTCAGCTATTGCATTCATGATGAAGCAGTCAAGGGATGAGAAGCAGAAAGGGTTGGATCATACTCATAGGCCAAGTGATCATAGGAGGGTGAGAAAAAGCTGGAGAACAAAAGTGGAGGAGATAGTGGATTCCCACATGAGGAAGATCATACAGACTCAAGATGCTTGGATGGAGAGAATGTTGAGTGTTGTTGAGCAAAGAGAGCAAGAGATGGCATCTAGGGAGGAAGAAAGGAAGAGAAAAGAGTCAATGTGGTTTGACCAACAGGTGCATGAACTGTGGGCCAAAGAGAAAGCATGGGTTGAGGCAAGAGATGCTGCATTGATAGAGGTTGTGAGGAAACACATTGGGATAGGGATAGGACTTGAAGCATTGCCATTGGTCGAAGAAGAATCACCGAATAAGAATAAGAGCCAGGGAAGTATTGATGCCAATGAGTTTCCCTCTGAGGGTGTTGATCCTGGTAGAAGTAGTAGTAGTAGGTGGACAGAAATGGAGATTTCAAATTTGATGCAGCTAAGGACTAGTTTTGAGCAAAGATTCAGAGAAAATAATAATGGGTACATGGAGAATGGGGTTTGGGATGAAATAGCAGCAAAAATGGCTTGTTTGGGGTTTGATAGGAGTGCAAGTGAGTGCAAGCAAATATGGGAAGAGATCAGCATCTCTCTCAGAAGGACAGTGGATGAGTGTGATGATGGTGCAAAAAGAAGGCCTTGGTATTTGGGACTTAAGCTGACGGATGATGATCTTTGA

>Glyma20g32940.1   sequence type=predicted peptide   gene model=Glyma20g32940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGDPYGLPEDLRRLIPARSTHLNPSDTHLIEPLCVHHGLSSAVAAATASATPPITYDANMVGDVFFPRGFTHHFAHHHDYSSSSGVNPVATTATATATTTVSDHAFCSMESAEKGWFGFDSGNNRWPRQETLSLLEIRSRLDSKFRENNQKAPLWNEISRIMAEEFGYQRSGKKCKEKFENLYKYYKKTKEGKASRQDGKHYRFFRQLEAICGDQANNTHAHASTSDKTHRAGGNTAATIQKQTFTTNQDHNNGDSNNNPKCSESLSISNSSQFETSSSENNDEDLSAIAFMMKQSRDEKQKGLDHTHRPSDHRRVRKSWRTKVEEIVDSHMRKIIQTQDAWMERMLSVVEQREQEMASREEERKRKESMWFDQQVHELWAKEKAWVEARDAALIEVVRKHIGIGIGLEALPLVEEESPNKNKSQGSIDANEFPSEGVDPGRSSSSRWTEMEISNLMQLRTSFEQRFRENNNGYMENGVWDEIAAKMACLGFDRSASECKQIWEEISISLRRTVDECDDGAKRRPWYLGLKLTDDDL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo