SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g31170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g31170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g31170

Feature Type:gene_model
Chromosome:Gm20
Start:39837193
stop:39840193
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G71790AT Annotation by Michelle Graham. TAIR10: Subunits of heterodimeric actin filament capping protein Capz superfamily | chr1:26996869-26998785 FORWARD LENGTH=256 SoyBaseE_val: 5.00E-148ISS
GO:0007015GO-bp Annotation by Michelle Graham. GO Biological Process: actin filament organization SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0030036GO-bp Annotation by Michelle Graham. GO Biological Process: actin cytoskeleton organization SoyBaseN/AISS
GO:0051693GO-bp Annotation by Michelle Graham. GO Biological Process: actin filament capping SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0008290GO-cc Annotation by Michelle Graham. GO Cellular Compartment: F-actin capping protein complex SoyBaseN/AISS
GO:0003779GO-mf Annotation by Michelle Graham. GO Molecular Function: actin binding SoyBaseN/AISS
KOG3174 KOG F-actin capping protein, beta subunit JGI ISS
PTHR10619Panther F-ACTIN CAPPING PROTEIN BETA SUBUNIT JGI ISS
PF01115PFAM F-actin capping protein, beta subunit JGI ISS
UniRef100_I1NH67UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NH67_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q9M9G7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Probable F-actin-capping protein subunit beta n=1 Tax=Arabidopsis thaliana RepID=CAPZB_ARATH SoyBaseE_val: 2.00E-145ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g31170 not represented in the dataset

Glyma20g31170 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g36400 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g171800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g31170.1   sequence type=CDS   gene model=Glyma20g31170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGCTGCGATGGGACTGATGCGGAGGATTCCTCCGAAACACACAGAAACAGCTCTGTCAGCGCTTCTGAGCCTTATGCCTGACAACTCCTCCGATCTCCTCTCTCAAGTCGATCAGCCCCTCCAGGTTCTGTGCGATGTGGAATGCGGCAAGGAGTTCATTTTGTGCGAATACAATAGAGATGCCGACTCTTACAGATCACCTTGGTCCAATAAATACCATCCACCATTAGAAGATGGGTCCCTCCCTTCTTCAGAGTTGCGGAAGCTTGAAATTGAAGCAAATGACATATTTGCAATATATCGTGACCAGTATTATGAAGGTGGCATTTCATCAGTTTACATGTGGGAAGATGATAATGAAGGTTTCGTAGCCTGCTTTTTAATAAAGAAAGATGGCTCAAAGACAGGGCAGGGCCGACGGGGATATTTAGAGGAAGGTGCATGGGATGCTATACATGTTATAGAGGTGGGACCAGAGGAAGAAGAAAACACCAATTATCGTTTAACCAGTACAGTTATGCTGACTCTGACTACAAATAATGAGTCATCCGGAACTTTCAGTTTATCTGGTTCAATTAGGCGTCAGATGAGTATGAAGCTATCAGTTGCTGATGGGCATCTTTGTAACATGGGAAGGATGATTGAAGAAATGGAGAGTAAGCTGAGGAACTCACTAGATCAGGTATACTTTGGGAAAACAAGAGAAAATGGTTTGCACACTGAGACCACCATCTGA

>Glyma20g31170.1   sequence type=predicted peptide   gene model=Glyma20g31170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEAAMGLMRRIPPKHTETALSALLSLMPDNSSDLLSQVDQPLQVLCDVECGKEFILCEYNRDADSYRSPWSNKYHPPLEDGSLPSSELRKLEIEANDIFAIYRDQYYEGGISSVYMWEDDNEGFVACFLIKKDGSKTGQGRRGYLEEGAWDAIHVIEVGPEEEENTNYRLTSTVMLTLTTNNESSGTFSLSGSIRRQMSMKLSVADGHLCNMGRMIEEMESKLRNSLDQVYFGKTRENGLHTETTI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo