SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g29740

Feature Type:gene_model
Chromosome:Gm20
Start:38569567
stop:38572577
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g29740
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G23750AT Annotation by Michelle Graham. TAIR10: Remorin family protein | chr5:8010004-8011453 REVERSE LENGTH=201 SoyBaseE_val: 4.00E-67ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0042546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
PF03763PFAM Remorin, C-terminal region JGI ISS
PF03766PFAM Remorin, N-terminal region JGI ISS
UniRef100_G8A207UniRef Annotation by Michelle Graham. Most informative UniRef hit: Remorin n=1 Tax=Medicago truncatula RepID=G8A207_MEDTR SoyBaseE_val: 5.00E-79ISS
UniRef100_I1NGT0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NGT0_SOYBN SoyBaseE_val: 1.00E-133ISS

Expression Patterns of Glyma20g29740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g29740
ParalogEvidenceComments
Glyma10g38080 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g29740 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g158200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g29740
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g29740
>Glyma20g29740.1   sequence type=CDS   gene model=Glyma20g29740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAGAGGAGCAATTAAAAAAGGTGGCTCAGACTGAGAGTATTTCCCCTAATCCTGCACCTGAACCTGAACCTGAACCTGCTGTTCCAAAAGAGGAAGTGGCTGAGGAGAAATCTGTAATTCCACAACCCTCTTCCTCTCCTTCTGATGAGTCCAAAGCTCTTGTCATAGTTGAGAAGACTAGTGAAGTTGCTCAAGAGAAACCAATTGAGGGGTCTGTGAACCGAGATGCTGTCCTTGCGAGAGTTGCAACTGAGAAGAGGCTGTCACTAATCAAAGCATGGGAAGAAAGTGAAAAGTCAAAATCAGAGAACAAGTCTCACAAAAAGCTTTCAGTCATTTCAGCATGGGAGAACAGTATGAAAGCTGCAGCGGAGGCAGAATTGAGAAAGATTGAAGAACAACTGGAGAAGAAAAAAGCAGAATATGGAGAGAAATTGAAAAACAAAATAGCTACAATCCACCGAGAAGCTGAAGAAAAGAGGGCATTTATTGAGGCCCAAAAAGGGGAAGATTTCTTGAAGGCAGAGGAGACAGCTGCAAAGTACAGGGCAACTGGAACAGCCCCAACGAAACTCTTTGGTTGTTTCTAA
Predicted protein sequences of Glyma20g29740
>Glyma20g29740.1   sequence type=predicted peptide   gene model=Glyma20g29740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEEQLKKVAQTESISPNPAPEPEPEPAVPKEEVAEEKSVIPQPSSSPSDESKALVIVEKTSEVAQEKPIEGSVNRDAVLARVATEKRLSLIKAWEESEKSKSENKSHKKLSVISAWENSMKAAAEAELRKIEEQLEKKKAEYGEKLKNKIATIHREAEEKRAFIEAQKGEDFLKAEETAAKYRATGTAPTKLFGCF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo