Report for Sequence Feature Glyma20g29721
Feature Type: gene_model
Chromosome: Gm20
Start: 38558238
stop: 38560490
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma20g29721
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G52270 AT
Annotation by Michelle Graham. TAIR10: SNARE-like superfamily protein | chr5:21221643-21222600 REVERSE LENGTH=214
SoyBase E_val: 3.00E-33 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0016192 GO-bp
Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0016021 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG0859
KOG
Synaptobrevin/VAMP-like protein
JGI ISS
PTHR21136 Panther
SNARE PROTEINS
JGI ISS
PTHR21136:SF88 Panther
JGI ISS
UniRef100_Q9LTJ4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Vesicle transport protein SEC22 n=1 Tax=Arabidopsis thaliana RepID=Q9LTJ4_ARATH
SoyBase E_val: 2.00E-30 ISS
UniRef100_UPI000233DA3C UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233DA3C related cluster n=1 Tax=unknown RepID=UPI000233DA3C
SoyBase E_val: 1.00E-109 ISS
Expression Patterns of Glyma20g29721
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma20g29721
Paralog Evidence Comments
Glyma10g38101 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma20g29721 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.20g158000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma20g29721
Coding sequences of Glyma20g29721
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma20g29721.1 sequence type=CDS gene model=Glyma20g29721 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCACTTGCCTTTTTTGGTTTTTTATTCCTCTCTAGTTTCTTAAGTTGCATTGCAATAAATTTTGATTATGATTATACTCTTTTGGTATTAAGCTACTTGGTCGAGAACGGAGTTGTTTTCATTGTGTTGTGTGAGTCCACGTACCCAAGAAAACTGGCCTTCCATTACCTACAAGATATACAAAAGGAGTTTGAGAAGTTTGATAAAACCCTCATAGGCAAAATCACAAGGCCATACAGCTTTGTCAAATTTGATGGTATAATCGCAAACATTAGCAGACAATACATTGATACAAGAACTCAGGCCAACCTATCAAAACTTAACGCTAACCGGAAACAAGATTTAGATATTGCCACTGAAGACATTTACAAAATTTTAGAAAGGAAGAGAAATTCAGAAACAATGAGAAGATTACCGGTTACTCCTCAACCTGAATCCACAATATGGTGCTCCCCACAACTTGAGGTGATTGCATTGAAATGGACACCTATTATGATCATTGTCATTACTTCGATGGCTCTTTTATGGGCTAGCTTAGCCCTCACAGATGACTTTATTGTTTGA
Predicted protein sequences of Glyma20g29721
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma20g29721.1 sequence type=predicted peptide gene model=Glyma20g29721 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MALAFFGFLFLSSFLSCIAINFDYDYTLLVLSYLVENGVVFIVLCESTYPRKLAFHYLQDIQKEFEKFDKTLIGKITRPYSFVKFDGIIANISRQYIDTRTQANLSKLNANRKQDLDIATEDIYKILERKRNSETMRRLPVTPQPESTIWCSPQLEVIALKWTPIMIIVITSMALLWASLALTDDFIV*