Glyma20g28080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g28080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g28080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g28080

Feature Type:	gene_model
Chromosome:	Gm20
Start:	37025800
stop:	37028992
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g28080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G05290	AT	Annotation by Michelle Graham. TAIR10: peroxisomal adenine nucleotide carrier 1 \| chr3:1506129-1507614 REVERSE LENGTH=322	SoyBase	E_val: 1.00E-159	ISS
GO:0006635	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0006839	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitochondrial transport	SoyBase	N/A	ISS
GO:0007031	GO-bp	Annotation by Michelle Graham. GO Biological Process: peroxisome organization	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0015866	GO-bp	Annotation by Michelle Graham. GO Biological Process: ADP transport	SoyBase	N/A	ISS
GO:0015867	GO-bp	Annotation by Michelle Graham. GO Biological Process: ATP transport	SoyBase	N/A	ISS
GO:0043161	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process	SoyBase	N/A	ISS
GO:0051788	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to misfolded protein	SoyBase	N/A	ISS
GO:0080024	GO-bp	Annotation by Michelle Graham. GO Biological Process: indolebutyric acid metabolic process	SoyBase	N/A	ISS
GO:0080129	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly	SoyBase	N/A	ISS
GO:0090351	GO-bp	Annotation by Michelle Graham. GO Biological Process: seedling development	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005743	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane	SoyBase	N/A	ISS
GO:0005777	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: peroxisome	SoyBase	N/A	ISS
GO:0005347	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015217	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ADP transmembrane transporter activity	SoyBase	N/A	ISS
KOG0769	KOG	Predicted mitochondrial carrier protein	JGI		ISS
PTHR24089	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24089:SF36	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00153	PFAM	Mitochondrial carrier protein	JGI		ISS
UniRef100_B9RTX9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peroxisomal membrane protein pmp34, putative n=1 Tax=Ricinus communis RepID=B9RTX9_RICCO	SoyBase	E_val: 3.00E-168	ISS
UniRef100_UPI0001B640B4	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001B640B4 related cluster n=1 Tax=unknown RepID=UPI0001B640B4	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma20g28080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g28080 not represented in the dataset	Glyma20g28080 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g28080

Paralog	Evidence	Comments
Glyma10g39681	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g28080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g142800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g28080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g28080

Limit To All Plant Sequences

>Glyma20g28080.1   sequence type=CDS   gene model=Glyma20g28080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAACTTGATCTGGAATCATTATCCGAAGCTACTTCTGGTGCCATTGGATCACTTGTTAGTACCACCGTCTTGTACCCGCTTGATACTTGCAAGACCAAATATCAAGCTGAAGTTCAAGCTCAGCATCAGCGCAAATACAAGAGAATTTCTGATGTATTATGGGAAGCAATTTCTACTCGTCAGGTGCTTTCATTGTACCAAGGCCTTGGGACTAAAAACGTTCAGTCCTTCATTTCATCGTTCATTTATTTCTATGGATACAGCTACTTTAGGAAGATGTATTTGAAAAAAACAGGAAACAAGTCCATTGGAACAACAGCTAATTTGATTGTTGCCACTGCTGCTGGGGTCTGTACAATAGTAATAACACAGCCCTTAGATACAGCATCCTCAAGGATGCAGACAAGTGAATTTGGAAAATCCAAGGGACTCTGGAAGACCCTTTCTGAGGGTACATGGAGTGAAGCATATGACGGACTTGGCATTTCCATTCTTTTAACAACAAATCCATCTATTCAGTATACTGCATATGATCAGCTGAAACAGAGAATATTAAAGGGCAAGATAAGCAACAGAACAGGTACAAAGTCATCCCCGGAAGCACTTTCTGCATTTTATGCTTTCATGCTTGGTGCAGTTTCAAAATGTGCAGCGACCATCTTGACATACCCAGCTATCAGGTGTAAGGTCATGATTCAGGCTGCTGAATCTGAAGATGATAAGAGTACAGAAGCTGAGAGGAAGGCGCAGAGGACAATCTCTGGAGCACTCTATACTATTTGGAAAAGAGAAGGTATATTGGGATTTTTCAAAGGATTGCAGGCACAGATATTGAAAACTGTTCTCAGCTCTGCGTTACTTCTGATGGTGAAGGAGAAGATTGCAAAGTCCACATGGATTCTAATGCTTGTGATTGGAAGATACTTGTCTGTGAATTCCCCCAAATTGAAGGCAGTTTGA

Predicted protein sequences of Glyma20g28080

Limit To All Plant Sequences

>Glyma20g28080.1   sequence type=predicted peptide   gene model=Glyma20g28080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQLDLESLSEATSGAIGSLVSTTVLYPLDTCKTKYQAEVQAQHQRKYKRISDVLWEAISTRQVLSLYQGLGTKNVQSFISSFIYFYGYSYFRKMYLKKTGNKSIGTTANLIVATAAGVCTIVITQPLDTASSRMQTSEFGKSKGLWKTLSEGTWSEAYDGLGISILLTTNPSIQYTAYDQLKQRILKGKISNRTGTKSSPEALSAFYAFMLGAVSKCAATILTYPAIRCKVMIQAAESEDDKSTEAERKAQRTISGALYTIWKREGILGFFKGLQAQILKTVLSSALLLMVKEKIAKSTWILMLVIGRYLSVNSPKLKAV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain