SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g25920): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g25920): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g25920

Feature Type:gene_model
Chromosome:Gm20
Start:35530504
stop:35534470
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G08680AT Annotation by Michelle Graham. TAIR10: ATP synthase alpha/beta family protein | chr5:2821992-2824683 FORWARD LENGTH=559 SoyBaseE_val: 0ISS
GO:0006200GO-bp Annotation by Michelle Graham. GO Biological Process: ATP catabolic process SoyBaseN/AISS
GO:0006754GO-bp Annotation by Michelle Graham. GO Biological Process: ATP biosynthetic process SoyBaseN/AISS
GO:0015986GO-bp Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport SoyBaseN/AISS
GO:0015991GO-bp Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport SoyBaseN/AISS
GO:0046034GO-bp Annotation by Michelle Graham. GO Biological Process: ATP metabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0000275GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005753GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016469GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex SoyBaseN/AISS
GO:0033178GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, catalytic domain SoyBaseN/AISS
GO:0045261GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting ATP synthase complex, catalytic core F(1) SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen-exporting ATPase activity, phosphorylative mechanism SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0046933GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism SoyBaseN/AISS
GO:0046961GO-mf Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism SoyBaseN/AISS
KOG1350 KOG F0F1-type ATP synthase, beta subunit JGI ISS
PTHR15184Panther ATP SYNTHASE JGI ISS
PTHR15184:SF8Panther gb def: invasion protein [shigella flexneri] JGI ISS
PF00006PFAM ATP synthase alpha/beta family, nucleotide-binding domain JGI ISS
PF00306PFAM ATP synthase alpha/beta chain, C terminal domain JGI ISS
PF02874PFAM ATP synthase alpha/beta family, beta-barrel domain JGI ISS
PF11421PFAM ATP synthase F1 beta subunit JGI ISS
UniRef100_I1NFS4UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP synthase subunit beta n=1 Tax=Glycine max RepID=I1NFS4_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1NFS4UniRef Annotation by Michelle Graham. Best UniRef hit: ATP synthase subunit beta n=1 Tax=Glycine max RepID=I1NFS4_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g25920 not represented in the dataset

Glyma20g25920 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g41330 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g123600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g25920.1   sequence type=CDS   gene model=Glyma20g25920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCACGCAGGTTCGTATCTTCTCTGATTCGATCCTCCCTTCGTAGATCTCAATCGAAACCCTCGATTTCCGCATCCGCATCGAGGCTCACGTCATCCAACCGTGCCTCTCCGCACGGTTACTTGCTGAACCGCGTCGCCGAATACGCTACCGCGGCGGCGGCTGCTACCGCTCCTCCCTCTGCTCCGCCTCCGGGCAAGAAGGAGGTTAGCGGCGGCGGGAAGATCACCGATGAGTTCACCGGGAAGGGCTCGATCGGGCAGGTCTGCCAGGTCATCGGTGCCGTCGTCGATGTCAGATTCGACGAGGGTTTGCCTCCGATCATGACCGCGCTGGAGGTTCTGGATCACTCCTCGAGGCTCGTGTTGGAGGTGGCTCAGCATTTGGGTGAGGGCGTTGTCCGAACCATTGCCATGGATGCCACCGAAGGGGTCGTTAGAGGGTGGCGCGTCCTCAACACTGGCTCCCCTATTACCGTTCCAGTTGGTAGGGCTACCCTTGGCCGTATCATAAATGTCATTGGAGAGCCTATTGATGACAAGGGAGAAATCAATACCGAGCATTATTTGCCCATTCATAGAGAAGCTCCTGCTTTTGTTGAGCAAGAAACCGCACAGCAGATTCTTGTTACTGGAATCAAGGTTGTTGACCTGCTTGCACCATATCAAAGAGGAGGAAAGATTGGGTTGTTTGGTGGTGCTGGTGTAGGAAAAACTGTGCTTATTATGGAACTTATTAACAATGTTGCAAAAGCTCATGGTGGTTTCTCTGTGTTTGCTGGTGTTGGAGAGCGAACCCGAGAGGGTAATGACTTGTACAGAGAAATGATTGAGAGTGGTGTCATTAAGCTTGGTGATAAGCAGAGTGAAAGCAAATGTGCTCTTGTGTATGGTCAAATGAATGAGCCCCCTGGTGCTCGTGCCCGTGTTGGTCTTACTGGGCTTACTGTGGCTGAACACTTCCGTGATGCTGAAGGGCAAGATGTGCTTCTTTTTGTAGACAACATTTTCCGTTTTACCCAAGCTAACTCAGAGGTGTCTGCTTTGCTTGGTCGTATCCCATCTGCTGTTGGTTACCAACCAACCTTGTCTACTGATCTTGGAGCTCTTCAAGAGCGTATTACAACAACCAAGAAGGGCTCAATTACCTCTGTCCAAGCTATCTATGTGCCTGCTGATGACTTGACAGATCCTGCTCCTGCTACCACTTTTGCTCACTTGGATGCCACAACAGTGTTATCACGACAGATCTCCGAGCTTGGTATCTATCCTGCTGTTGACCCCTTGGATTCTACATCTCGTATGCTTTCCCCCCTTATTTTGGGTGCGGATCACTATGAAACTGCTCGTGGTGTACAGAAAGTACTTCAGAACTACAAGAATCTTCAAGATATCATTGCTATTTTGGGAATGGATGAGCTCAGTGAAGATGATAAATTGACTGTTGCCCGTGCCCGTAAGATTCAGCGATTCTTAAGCCAGCCTTTCCATGTTGCAGAAGTCTTCACTGGTGCCCCAGGAAAATATGTTGAGTTGAAGGAGAACATCACCAGTTTCCAGGGTGTGTTGGATGGCAAATACGATGACCTCCCAGAGCAGTCGTTTTACATGGTTGGCGGTATTGAAGAGGTCATTGCTAAGGCTGAGAAAATTGCTAAGGAATCTGCAGCGTCTTAA

>Glyma20g25920.1   sequence type=predicted peptide   gene model=Glyma20g25920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASRRFVSSLIRSSLRRSQSKPSISASASRLTSSNRASPHGYLLNRVAEYATAAAAATAPPSAPPPGKKEVSGGGKITDEFTGKGSIGQVCQVIGAVVDVRFDEGLPPIMTALEVLDHSSRLVLEVAQHLGEGVVRTIAMDATEGVVRGWRVLNTGSPITVPVGRATLGRIINVIGEPIDDKGEINTEHYLPIHREAPAFVEQETAQQILVTGIKVVDLLAPYQRGGKIGLFGGAGVGKTVLIMELINNVAKAHGGFSVFAGVGERTREGNDLYREMIESGVIKLGDKQSESKCALVYGQMNEPPGARARVGLTGLTVAEHFRDAEGQDVLLFVDNIFRFTQANSEVSALLGRIPSAVGYQPTLSTDLGALQERITTTKKGSITSVQAIYVPADDLTDPAPATTFAHLDATTVLSRQISELGIYPAVDPLDSTSRMLSPLILGADHYETARGVQKVLQNYKNLQDIIAILGMDELSEDDKLTVARARKIQRFLSQPFHVAEVFTGAPGKYVELKENITSFQGVLDGKYDDLPEQSFYMVGGIEEVIAKAEKIAKESAAS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo