Glyma20g22700 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g22700

Feature Type:	gene_model
Chromosome:	Gm20
Start:	32618509
stop:	32620443
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g22700

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G47180	AT	Annotation by Michelle Graham. TAIR10: galactinol synthase 1 \| chr2:19369049-19370372 REVERSE LENGTH=344	SoyBase	E_val: 0	ISS
GO:0006012	GO-bp	Annotation by Michelle Graham. GO Biological Process: galactose metabolic process	SoyBase	N/A	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0016051	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate biosynthetic process	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
GO:0016758	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring hexosyl groups	SoyBase	N/A	ISS
GO:0047216	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol 3-alpha-galactosyltransferase activity	SoyBase	N/A	ISS
KOG1950	KOG	Glycosyl transferase, family 8 - glycogenin	JGI		ISS
PTHR11183	Panther	GLYCOGENIN	JGI		ISS
PTHR11183:SF2	Panther	GLYCOGENIN-RELATED	JGI		ISS
PF01501	PFAM	Glycosyl transferase family 8	JGI		ISS
UniRef100_Q7XZ08	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Galactinol synthase n=1 Tax=Glycine max RepID=Q7XZ08_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_UPI0000F1C1FA	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0000F1C1FA related cluster n=1 Tax=unknown RepID=UPI0000F1C1FA	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma20g22700

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g22700

Paralog	Evidence	Comments
Glyma10g28610	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g22700 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g094500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g22700

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g22700

Limit To All Plant Sequences

>Glyma20g22700.1   sequence type=CDS   gene model=Glyma20g22700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCCTAATATCACCACCGTCACCGACGCTCAAGCCAAGGCCGCCGGCGGGCGTGGCCGTGCCTACGTCACCTTCCTCGCCGGAAACGGTGACTATGTGAAAGGTGTCGTTGGCTTGGCCAAAGGTCTGAGGAAGGTGAAAAGCATGTACCCTCTGGTGGTTGCAGTGTTACCCGATGTTCCAGAACATCACCGAAACATTCTCACCTCCCAAGGTTGCATTGTTAGAGAAATTGAACCCGTGTACCCTCCTGAGAATCAGACGCAGTTCGCCATGGCATATTACGTCATCAACTATTCCAAGCTACGTATTTGGGAGTTTGTGGAGTTCAGCAAGATGATATACCTAGACGGTGATATACAAGTGTTTGACAATATTGACCACTTGTTTGACTTGCCTGATAACTACTTTTATGCGGTGATGGACTGTTTTTGTGAGCCCACTTGGGGCCACACTCTGCAGTATCAAATCGGATACTGCCAGCAGTGCCCTCATAAGGTTCAGTGGCCCACTCACTTTGGGCCCAAGCCTCCTCTCTATTTCAATGCTGGCATGTTTGTTTATGAGCCCAATCTGGATACCTACCGTGACCTCCTTCAAACTGTCCAAGTCACTAAGCCCACTTCCTTTGCTGAACAGGATTTTTTGAACATGTACTTCAAGGACAAATATAGGCCAATTCCTAATGTCTATAATCTTGTGTTGGCCATGCTGTGGCGTCACCCTGAGAACGTTGAGCTTGAAAAAGTTAAAGTGGTTCACTACTGTGCTGCTGGATCTAAGCCTTGGAGGTACACAGGGAAGGAGGAAAATATGGAGAGAGAAGATATCAAGATGTTGGTGAAGAAGTGGTGGGATATATATGAGGATGAGACTTTGGACTACAACAATCCATTCAACGTGGATAGGTTCACTGCGGCACTTTTGGAGGTTGGTGAAGTCAAGTTCGTCCGTGCCCCATCTGCTGCTTAG

Predicted protein sequences of Glyma20g22700

Limit To All Plant Sequences

>Glyma20g22700.1   sequence type=predicted peptide   gene model=Glyma20g22700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPNITTVTDAQAKAAGGRGRAYVTFLAGNGDYVKGVVGLAKGLRKVKSMYPLVVAVLPDVPEHHRNILTSQGCIVREIEPVYPPENQTQFAMAYYVINYSKLRIWEFVEFSKMIYLDGDIQVFDNIDHLFDLPDNYFYAVMDCFCEPTWGHTLQYQIGYCQQCPHKVQWPTHFGPKPPLYFNAGMFVYEPNLDTYRDLLQTVQVTKPTSFAEQDFLNMYFKDKYRPIPNVYNLVLAMLWRHPENVELEKVKVVHYCAAGSKPWRYTGKEENMEREDIKMLVKKWWDIYEDETLDYNNPFNVDRFTAALLEVGEVKFVRAPSAA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain