Glyma20g22690 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g22690

Feature Type:	gene_model
Chromosome:	Gm20
Start:	32612282
stop:	32614569
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g22690

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G02270	AT	Annotation by Michelle Graham. TAIR10: non-intrinsic ABC protein 9 \| chr5:467269-469041 REVERSE LENGTH=328	SoyBase	E_val: 2.00E-144	ISS
GO:0006007	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucose catabolic process	SoyBase	N/A	ISS
GO:0009744	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus	SoyBase	N/A	ISS
GO:0009813	GO-bp	Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010224	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to UV-B	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
KOG2355	KOG	Predicted ABC-type transport, ATPase component/CCR4 associated factor	JGI		ISS
PTHR12847	Panther	UNCHARACTERIZED	JGI		ISS
PF00005	PFAM	ABC transporter	JGI		ISS
UniRef100_G7IAA4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter family protein n=1 Tax=Medicago truncatula RepID=G7IAA4_MEDTR	SoyBase	E_val: 2.00E-161	ISS
UniRef100_I1NEW8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NEW8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma20g22690

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g22690

Paralog	Evidence	Comments
Glyma10g28600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g22690 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma20g22690

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g22690

Limit To All Plant Sequences

>Glyma20g22690.1   sequence type=CDS   gene model=Glyma20g22690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACCACTATCCTCAAGATATTAGGAGGGAAGCACTTGGTGGAGCCTGACATGGTTCGCGTGCTCGGAAGACCAGCTTTTCACGACACCACTCTAATATCTTCTGGTCATCTCTGTTACCTTGGTGGCGAGTGGAGGCAAGATGTTGCTTTTGCGGGTTTTGAGGTTCCAATACAAATGGACATATCTGCTCAAAAAATGATATTTGGTGTGCCTGGGATTGATCCTCAAAGAAGAGACGAGCTAATCAAGGTATTAGATATCGATCTTTCCTGGAGATTGCATAAAGTATCTGATGGACAAAGACGAAGGGTGCAAATTTGTATGGGTCTCCTCAAACCATTCAAGGTTCTTCTTCTCGATGAGATAACGGTTGACCTTGATGTCCTAGCAAGAGCTGACCTTCTGAGATTTCTAAGAAAGGAATGTGACGAGATGGGTGCCACTATTATCTATGCAACACATATATTTGATGGTCTTGAGGATTGGCCAACAAATATTGTTTATGTAGCCCATGGGAAGCTGCAACTAGCAATGCCTATGGACAAAAGAACAGTAGAAAGTTGGCTGCGGAAAGAACGAGATGAAGATAGAAAGAAAAGGAAAGAGAGAAAAGCAGCTGGTCTTCCTGAATTTGGAAAGCAAGTTGTGGGAAGCCATGTAACAGGGGATCCAGCGCGTGCTGCAGTTCAAGTAATTAATAATGGTTGGGCTGCAGGACGATTAAATTCCACCATTGCTGGCGAGGAAAACTTTCTCCTGAGCTCAAACCGAGTATTGAGGCAGTAG

Predicted protein sequences of Glyma20g22690

Limit To All Plant Sequences

>Glyma20g22690.1   sequence type=predicted peptide   gene model=Glyma20g22690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTILKILGGKHLVEPDMVRVLGRPAFHDTTLISSGHLCYLGGEWRQDVAFAGFEVPIQMDISAQKMIFGVPGIDPQRRDELIKVLDIDLSWRLHKVSDGQRRRVQICMGLLKPFKVLLLDEITVDLDVLARADLLRFLRKECDEMGATIIYATHIFDGLEDWPTNIVYVAHGKLQLAMPMDKRTVESWLRKERDEDRKKRKERKAAGLPEFGKQVVGSHVTGDPARAAVQVINNGWAAGRLNSTIAGEENFLLSSNRVLRQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain