SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g22690): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g22690): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g22690

Feature Type:gene_model
Chromosome:Gm20
Start:32612282
stop:32614569
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G02270AT Annotation by Michelle Graham. TAIR10: non-intrinsic ABC protein 9 | chr5:467269-469041 REVERSE LENGTH=328 SoyBaseE_val: 2.00E-144ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009813GO-bp Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0080167GO-bp Annotation by Michelle Graham. GO Biological Process: response to karrikin SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
KOG2355 KOG Predicted ABC-type transport, ATPase component/CCR4 associated factor JGI ISS
PTHR12847Panther UNCHARACTERIZED JGI ISS
PF00005PFAM ABC transporter JGI ISS
UniRef100_G7IAA4UniRef Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter family protein n=1 Tax=Medicago truncatula RepID=G7IAA4_MEDTR SoyBaseE_val: 2.00E-161ISS
UniRef100_I1NEW8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1NEW8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g22690 not represented in the dataset

Glyma20g22690 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g28600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g22690.1   sequence type=CDS   gene model=Glyma20g22690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACCACTATCCTCAAGATATTAGGAGGGAAGCACTTGGTGGAGCCTGACATGGTTCGCGTGCTCGGAAGACCAGCTTTTCACGACACCACTCTAATATCTTCTGGTCATCTCTGTTACCTTGGTGGCGAGTGGAGGCAAGATGTTGCTTTTGCGGGTTTTGAGGTTCCAATACAAATGGACATATCTGCTCAAAAAATGATATTTGGTGTGCCTGGGATTGATCCTCAAAGAAGAGACGAGCTAATCAAGGTATTAGATATCGATCTTTCCTGGAGATTGCATAAAGTATCTGATGGACAAAGACGAAGGGTGCAAATTTGTATGGGTCTCCTCAAACCATTCAAGGTTCTTCTTCTCGATGAGATAACGGTTGACCTTGATGTCCTAGCAAGAGCTGACCTTCTGAGATTTCTAAGAAAGGAATGTGACGAGATGGGTGCCACTATTATCTATGCAACACATATATTTGATGGTCTTGAGGATTGGCCAACAAATATTGTTTATGTAGCCCATGGGAAGCTGCAACTAGCAATGCCTATGGACAAAAGAACAGTAGAAAGTTGGCTGCGGAAAGAACGAGATGAAGATAGAAAGAAAAGGAAAGAGAGAAAAGCAGCTGGTCTTCCTGAATTTGGAAAGCAAGTTGTGGGAAGCCATGTAACAGGGGATCCAGCGCGTGCTGCAGTTCAAGTAATTAATAATGGTTGGGCTGCAGGACGATTAAATTCCACCATTGCTGGCGAGGAAAACTTTCTCCTGAGCTCAAACCGAGTATTGAGGCAGTAG

>Glyma20g22690.1   sequence type=predicted peptide   gene model=Glyma20g22690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTILKILGGKHLVEPDMVRVLGRPAFHDTTLISSGHLCYLGGEWRQDVAFAGFEVPIQMDISAQKMIFGVPGIDPQRRDELIKVLDIDLSWRLHKVSDGQRRRVQICMGLLKPFKVLLLDEITVDLDVLARADLLRFLRKECDEMGATIIYATHIFDGLEDWPTNIVYVAHGKLQLAMPMDKRTVESWLRKERDEDRKKRKERKAAGLPEFGKQVVGSHVTGDPARAAVQVINNGWAAGRLNSTIAGEENFLLSSNRVLRQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo