SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g22180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g22180): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g22180

Feature Type:gene_model
Chromosome:Gm20
Start:32105001
stop:32107396
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g22180
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G62020AT Annotation by Michelle Graham. TAIR10: germin-like protein 10 | chr3:22971443-22972192 REVERSE LENGTH=220 SoyBaseE_val: 4.00E-106ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0030145GO-mf Annotation by Michelle Graham. GO Molecular Function: manganese ion binding SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
PF00190PFAM Cupin JGI ISS
UniRef100_C7S8D5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 1 n=1 Tax=Glycine max RepID=C7S8D5_SOYBN SoyBaseE_val: 9.00E-126ISS
UniRef100_I1NES8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1NES8_SOYBN SoyBaseE_val: 1.00E-159ISS

Expression Patterns of Glyma20g22180
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g22180 not represented in the dataset
Glyma20g22180 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g22180
ParalogEvidenceComments
Glyma10g28190 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g22180 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g090200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g22180
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g22180
>Glyma20g22180.1   sequence type=CDS   gene model=Glyma20g22180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGGCTAACCATACCATGAAGATGGCCAACTTGTTGCTTCTCGTGACTTTGGCTCAGCTCTTAGCCACCGCAATCTCATCAGATCCTGACCTTCTTCAAGACCTCTGTGTCGCCGACCTTGCCTCAGGTGTGAAAGTGAATGGATTCACTTGCAAAGAAGCATCCAAGGTAAATGCCTCAGATTTCTTCTCAAACATACTAGCCAAACCAGGAGCCACCAACAACACATTTGGCTCCTTGGTGACTGGAGCCAACGTTCAGAAAGTCCCAGGACTCAACACACTTGGTGTCTCTCTGTCAAGAATTGACTATGCCCCAGGTGGCATCAACCCCCCTCACACCCACCCACGTGCCACAGAGCTTGTGTTTGTCCTTGAAGGCCAACTATATGTGGGATTCATAACCACATCTAATGTGCTCATATCAAAGACCATTAACAAGGGTGACATATTTGTGTTCCCAAAAGGCTTGCTTCACTTCCAAAAGAACAATGCTAAGGTTCCTGCTGCTGTGATTTCAGCCTTCAATAGCCAACTTCCAGGGACACAGTCCACTGCTACAACCTTGTTTGCTGCCACTCCATCTGTTCCAGACCATGTCTTGACCCAGACCTTCCAGGTTGGAACCAAGGAGGTTCAGAAAATCAAGTCTAGACTTGCACCAAAAAAGTAA
Predicted protein sequences of Glyma20g22180
>Glyma20g22180.1   sequence type=predicted peptide   gene model=Glyma20g22180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMANHTMKMANLLLLVTLAQLLATAISSDPDLLQDLCVADLASGVKVNGFTCKEASKVNASDFFSNILAKPGATNNTFGSLVTGANVQKVPGLNTLGVSLSRIDYAPGGINPPHTHPRATELVFVLEGQLYVGFITTSNVLISKTINKGDIFVFPKGLLHFQKNNAKVPAAVISAFNSQLPGTQSTATTLFAATPSVPDHVLTQTFQVGTKEVQKIKSRLAPKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo