SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g21115

Feature Type:gene_model
Chromosome:Gm20
Start:30131939
stop:30132547
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g21115
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G13770AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Putative harbinger transposase-derived nuclease (InterPro:IPR006912); Has 451 Blast hits to 352 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 8; Plants - 388; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). | chr2:5736603-5737847 FORWARD LENGTH=343 SoyBaseE_val: 2.00E-23ISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0016788GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on ester bonds SoyBaseN/AISS
PF04827PFAM Plant transposon protein JGI ISS
UniRef100_G7IJ40UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Medicago truncatula RepID=G7IJ40_MEDTR SoyBaseE_val: 9.00E-51ISS
UniRef100_G7L5H5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein-like protein n=1 Tax=Medicago truncatula RepID=G7L5H5_MEDTR SoyBaseE_val: 1.00E-48ISS

Expression Patterns of Glyma20g21115
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g21115 not represented in the dataset
Glyma20g21115 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g21115 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g082900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g21115
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g21115
>Glyma20g21115.1   sequence type=CDS   gene model=Glyma20g21115   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATCCAAACTTTGACTTTGATAGACTTTGGAAACAAATTGTTGATGAAATACTTGAAGATAACATTGAAGAAGAAATCATGAGGTACTTACGTGAAATGCTACTACAAGCAGAGAACAACAATCAACCTAAACGAAGAAGAATCATAAATCGCAATCGTGAAGACAGACATAGTCGCTTGTTGAATGACTCCTTCTGTGAAAATTATATATACACAGAGAGTCAATTTCGAAGAAGTAATCATGATTCGTATTTTCGAATGAGATTTGATGTAGTTGGTAGAATGGGTCTTTCACCATTGCATATTCGTATATTGGCATATGGATCACCTGTTGATAGTGTGAATGAGAACGTTAGAATTACCGAATGCACTACAATTCAATGCTTAGAAGCTTTTGTAAAGGGTGTTAACGAGATATTTGGGGATAAGTACTTGAGAAGGCCTAACAACAATGACATCAATTGCCTGCTACAAATTGGAGAGGCGCGGGGGTTTCCAGGTTTGTTGGGTTCTATTGATTGCATGCATTGGGAATGGAAAAATTGTCCAGTTGCATGA
Predicted protein sequences of Glyma20g21115
>Glyma20g21115.1   sequence type=predicted peptide   gene model=Glyma20g21115   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHPNFDFDRLWKQIVDEILEDNIEEEIMRYLREMLLQAENNNQPKRRRIINRNREDRHSRLLNDSFCENYIYTESQFRRSNHDSYFRMRFDVVGRMGLSPLHIRILAYGSPVDSVNENVRITECTTIQCLEAFVKGVNEIFGDKYLRRPNNNDINCLLQIGEARGFPGLLGSIDCMHWEWKNCPVA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo