SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma20g21064

Feature Type:gene_model
Chromosome:Gm20
Start:29989773
stop:29991402
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G15920AT Annotation by Michelle Graham. TAIR10: Nodulin MtN3 family protein | chr4:9030742-9033343 REVERSE LENGTH=241 SoyBaseE_val: 3.00E-39ISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005887GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0051119GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar transmembrane transporter activity SoyBaseN/AISS
PTHR10791Panther STROMAL CELL PROTEIN/NODULIN MTN3-RELATED JGI ISS
PF03083PFAM MtN3/saliva family JGI ISS
UniRef100_Q84WN3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Bidirectional sugar transporter SWEET17 n=1 Tax=Arabidopsis thaliana RepID=SWT17_ARATH SoyBaseE_val: 2.00E-36ISS
UniRef100_UPI000233DD86UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233DD86 related cluster n=1 Tax=unknown RepID=UPI000233DD86 SoyBaseE_val: 1.00E-81ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g21064 not represented in the dataset

Glyma20g21064 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g082700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma20g21064.1   sequence type=CDS   gene model=Glyma20g21064   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCTATCTCTGGTTCGACCCCACTAGAAACTTCCACGCTTATTCTATCATTTGGAAGCGCCAGCACATCATACCTATGTTTTGGAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGCTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGTCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGGTAGAACTCTCATTTTGGCTGTGATTTTGGATGTGGCAATTTCGGCAGTAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCATGGTGGTGTTGTTGGTGTTATGGGAGCAGGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTGCCATGAGGATGGCTGATGGAATCCATAAAGATCTTTGTTGCTTTGCGTCTCGGGTATCTCTAAGCCTTATACGAGAACATATACAACATATACAGTAA

>Glyma20g21064.1   sequence type=predicted peptide   gene model=Glyma20g21064   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFYLWFDPTRNFHAYSIIWKRQHIIPMFWKIKKHGSTEDFSSLPYICTLLNCSLWTYYGIIKAREYLVATVDGFGIVVETIYVILFLIYAPKGIRGRTLILAVILDVAISAVAVVTTQLALQREAHGGVVGVMGAGLNIVMYFSPLSAMRMADGIHKDLCCFASRVSLSLIREHIQHIQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo