SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g20543

Feature Type:gene_model
Chromosome:Gm20
Start:29264517
stop:29269633
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g20543
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G34260AT Annotation by Michelle Graham. TAIR10: transducin family protein / WD-40 repeat family protein | chr2:14465899-14468416 FORWARD LENGTH=353 SoyBaseE_val: 1.00E-111ISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0009553GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac development SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009960GO-bp Annotation by Michelle Graham. GO Biological Process: endosperm development SoyBaseN/AISS
GO:0010197GO-bp Annotation by Michelle Graham. GO Biological Process: polar nucleus fusion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005834GO-cc Annotation by Michelle Graham. GO Cellular Compartment: heterotrimeric G-protein complex SoyBaseN/AISS
GO:0080008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
KOG2444 KOG WD40 repeat protein JGI ISS
PTHR22840Panther FAMILY NOT NAMED JGI ISS
PF00400PFAM WD domain, G-beta repeat JGI ISS
UniRef100_G7JRY6UniRef Annotation by Michelle Graham. Most informative UniRef hit: WD-40 repeat protein n=1 Tax=Medicago truncatula RepID=G7JRY6_MEDTR SoyBaseE_val: 6.00E-155ISS
UniRef100_I1LAN2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LAN2_SOYBN SoyBaseE_val: 3.00E-164ISS

Expression Patterns of Glyma20g20543
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g20543 not represented in the dataset
Glyma20g20543 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g20543 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g080900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g20543
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g20543
>Glyma20g20543.1   sequence type=CDS   gene model=Glyma20g20543   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTGGAAGTTCATGCTCACACTGAGTCCTGCAGGGCTGCTCGATTCATCAACGGTGGACGTGCGATCTTGACAGGTTCTCCGGATTGCTTAATACTGGCTACAGATGTGGAAACTGGATCTACAATTGCTCGTCTTGATGATGCTCATGAGGCTGCGATAAATAGATTGATAAACTTGACTGAGTCAACTGTTGCCTCGGGAGATGATGAAGGTTGTATAAAGGTATGGGATATCAGAGAACGTTCTTGTTGCAATTCTTTTAATTCCCATGAAGATTACATTTCAGACATTACTTTTGTGTCTGATGCAATGAAACTGTTGGCAACAAGTGGAGATGGGACTCTGTCTGTTTGCAATCTTCGAAGAAATAAAGTGCAAGCTCAATCTGAATTTTCTGAAGATGAGCTACTGTCTGTGGTTTTAATGAAGCTTGATGAAGACAGGATTATTACCGGATCAGAGAATAGAATTATCAACCTGGTTGGGATATTACCAAACAGAGTCATCCAGCCAATTGCAGAACACTCAGAATATCCTGTTGAGTGTCTTGCATTCTCTCATGATAGGAAGTTTCTTGGAAGCATTTCCCATGATCAAATGTTAAAGCTATGGGACTTGGATAATATTCTACAAGGCTCAGGAAACACACAAAGTAATGAAGCTGGAGCTGTTGACAGTGACGATGATGAGATGGATCTAGATGATGATCCTTCAAAGAATAGTAAAGGGAACAAGAGAAAGAATGCAAATAATGGGAATGCCCTAGGTGGATCGAACAACTTCTTTGCAGATTTATAG
Predicted protein sequences of Glyma20g20543
>Glyma20g20543.1   sequence type=predicted peptide   gene model=Glyma20g20543   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLEVHAHTESCRAARFINGGRAILTGSPDCLILATDVETGSTIARLDDAHEAAINRLINLTESTVASGDDEGCIKVWDIRERSCCNSFNSHEDYISDITFVSDAMKLLATSGDGTLSVCNLRRNKVQAQSEFSEDELLSVVLMKLDEDRIITGSENRIINLVGILPNRVIQPIAEHSEYPVECLAFSHDRKFLGSISHDQMLKLWDLDNILQGSGNTQSNEAGAVDSDDDEMDLDDDPSKNSKGNKRKNANNGNALGGSNNFFADL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo