SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g20020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g20020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g20020

Feature Type:gene_model
Chromosome:Gm20
Start:28419020
stop:28420914
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g20020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G01190AT Annotation by Michelle Graham. TAIR10: Octicosapeptide/Phox/Bem1p family protein | chr2:115023-117296 FORWARD LENGTH=720 SoyBaseE_val: 6.00E-48ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
PF00564PFAM PB1 domain JGI ISS
UniRef100_I1NFP9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NFP9_SOYBN SoyBaseE_val: 2.00E-64ISS
UniRef100_Q9ZU48UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Arabidopsis thaliana RepID=Q9ZU48_ARATH SoyBaseE_val: 3.00E-45ISS

Expression Patterns of Glyma20g20020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g20020 not represented in the dataset
Glyma20g20020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g20020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma20g20020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g20020
>Glyma20g20020.1   sequence type=CDS   gene model=Glyma20g20020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCACACTCTCTCACCTCCAAATTCTCAAACTACATCTATTTCAAGGCCAAGACTAGGGTGCTTAAAGACAGCGAGGAAGCCGTCGCCTCTGCCGTCGCACCTCAGCTACCCCGACTCCGTGGAATCCTCGCCTCGTTCCCGCAACACCGACTCCTGGGACAAGCCCTTTGTGTCGACATCCACCAAGCTCCGTCTCATGTGCAGCTACGGTGGGCACATCGTCCCCTGCCCCCACGACAAGTCCCTCTGCTACGTGGGTGGTGACACGTGCATCATTGTGTCTGAACACGCCACGTCACTCGCAACCCTCTCCACGCGCCTCTCGAAAACTTTCCTGAACGGAAGACCCTTCACGCTTAAGTACCAGCTCCCCAACGAGGACCTCGATTCCCTCATCTCTGTCACCATCGATGAGGACCTCGAGAACATGATCAACGAGTACAACCGCACCGCCGCCTCGCGCATCTCCTCCATTTCCAGACTTGTCCCTCGTTTATTTTCTCTCTCATCTCTTCTTCTTCCACTTAGATCTGAGTTGCCTTCCTCGAGAAGAACGGCAGAGAAGGGGAAGAGAGAAGACAGAAAGGCAAAGTCCACATTTTTTTCTACTTGCTCGTTCATTTTCGTCTTCGTCCATCTCATTAGGAATGTGAGTTGA
Predicted protein sequences of Glyma20g20020
>Glyma20g20020.1   sequence type=predicted peptide   gene model=Glyma20g20020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVHTLSPPNSQTTSISRPRLGCLKTARKPSPLPSHLSYPDSVESSPRSRNTDSWDKPFVSTSTKLRLMCSYGGHIVPCPHDKSLCYVGGDTCIIVSEHATSLATLSTRLSKTFLNGRPFTLKYQLPNEDLDSLISVTIDEDLENMINEYNRTAASRISSISRLVPRLFSLSSLLLPLRSELPSSRRTAEKGKREDRKAKSTFFSTCSFIFVFVHLIRNVS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo