SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g19611

Feature Type:gene_model
Chromosome:Gm20
Start:27610027
stop:27611428
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g19611
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G20230AT Annotation by Michelle Graham. TAIR10: blue-copper-binding protein | chr5:6826626-6827408 FORWARD LENGTH=196 SoyBaseE_val: 3.00E-16ISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009646GO-bp Annotation by Michelle Graham. GO Biological Process: response to absence of light SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0015690GO-bp Annotation by Michelle Graham. GO Biological Process: aluminum cation transport SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0046658GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
PF02298PFAM Plastocyanin-like domain JGI ISS
UniRef100_B9SMH1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Blue copper protein, putative n=1 Tax=Ricinus communis RepID=B9SMH1_RICCO SoyBaseE_val: 4.00E-22ISS
UniRef100_I1KDD0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KDD0_SOYBN SoyBaseE_val: 1.00E-62ISS

Expression Patterns of Glyma20g19611
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g19611 not represented in the dataset
Glyma20g19611 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g19611 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g077900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g19611
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g19611
>Glyma20g19611.1   sequence type=CDS   gene model=Glyma20g19611   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAGGAACGTGGGTTTAAATATGATAGGATACTCCACCATTGCAATGGTTTTCATAATTGGTGTAACTAAAGCAACAGAATATATGGTTGGTGACAACTTCGGATGGAACGTTCCCTCCTATGAGAGCTTCTATATGGACTGGGCTAGAACCAAGAGATTCCATGTTGGTGACAAACTCATTTTCAGCTGGAGCGGAGAGCATTCGTTGGGAATTAGGAAAGACGATATTTATTACGAGAATTGCAGCACCAGCTTAGAAGGTGGTCTCACGTACATATTTAATGGTGCAACGATAAATTATACTATTGTTTCTACACCTGGGCCTGTCTATTTCATCTGCACAGTTGACGATCACTGTGAAAGAGGCCAGAAGTTTAGAATCAATGTGTCTGCTGCTCCTGCACTATCGTTTGGAATCTTATCTGCATTTCTCTCTAGCTTGGCTGTGTATTTCTGCTTCACCGTTACCAGTTAG
Predicted protein sequences of Glyma20g19611
>Glyma20g19611.1   sequence type=predicted peptide   gene model=Glyma20g19611   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARNVGLNMIGYSTIAMVFIIGVTKATEYMVGDNFGWNVPSYESFYMDWARTKRFHVGDKLIFSWSGEHSLGIRKDDIYYENCSTSLEGGLTYIFNGATINYTIVSTPGPVYFICTVDDHCERGQKFRINVSAAPALSFGILSAFLSSLAVYFCFTVTS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo