SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g17613

Feature Type:gene_model
Chromosome:Gm20
Start:24702031
stop:24702478
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g17613
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G20000AT Annotation by Michelle Graham. TAIR10: CDC27 family protein | chr2:8632324-8636900 REVERSE LENGTH=744 SoyBaseE_val: 5.00E-26ISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0007276GO-bp Annotation by Michelle Graham. GO Biological Process: gamete generation SoyBaseN/AISS
GO:0007346GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of mitotic cell cycle SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010071GO-bp Annotation by Michelle Graham. GO Biological Process: root meristem specification SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0032875GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA endoreduplication SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048829GO-bp Annotation by Michelle Graham. GO Biological Process: root cap development SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0051302GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell division SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005680GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anaphase-promoting complex SoyBaseN/AISS
GO:0005819GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spindle SoyBaseN/AISS
GO:0009504GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell plate SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR12558Panther ANAPHASE PROMOTING COMPLEX SUBUNIT JGI ISS
PTHR12558:SF22Panther HBT (HOBBIT), BINDING JGI ISS
UniRef100_G7ZYJ0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cell division cycle protein-like protein n=2 Tax=Medicago truncatula RepID=G7ZYJ0_MEDTR SoyBaseE_val: 2.00E-29ISS
UniRef100_I1N6L5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N6L5_SOYBN SoyBaseE_val: 1.00E-38ISS

Expression Patterns of Glyma20g17613
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g17613 not represented in the dataset
Glyma20g17613 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g17613 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma20g17613
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g17613
>Glyma20g17613.1   sequence type=CDS   gene model=Glyma20g17613   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGAATTGACGAGGCTTTGGATGTCCTAGAGGAGCTGAAAGAGGCACAACCTCATGAAAGTAGTGTCTATGCTTTGATGGGTAATATCTATGGAAGGCGTCACACGCATGAGAGAGCAATGTTTCATTATGGTGTTGCTTTGGATTTGAAACCATCTGTAACAAATGCTGCTACAATTAAGGTTATTGTTGAGAAATTGATTATACCTGATGAGTTCCAAGACAAAGATGATTGTTAG
Predicted protein sequences of Glyma20g17613
>Glyma20g17613.1   sequence type=predicted peptide   gene model=Glyma20g17613   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RIDEALDVLEELKEAQPHESSVYALMGNIYGRRHTHERAMFHYGVALDLKPSVTNAATIKVIVEKLIIPDEFQDKDDC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo