SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g17320

Feature Type:gene_model
Chromosome:Gm20
Start:24375052
stop:24379301
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g17320
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G22620AT Annotation by Michelle Graham. TAIR10: Phosphoinositide phosphatase family protein | chr1:7997889-8002787 REVERSE LENGTH=912 SoyBaseE_val: 5.00E-146ISS
GO:0006487GO-bp Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0032957GO-bp Annotation by Michelle Graham. GO Biological Process: inositol trisphosphate metabolic process SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0046855GO-bp Annotation by Michelle Graham. GO Biological Process: inositol phosphate dephosphorylation SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0004439GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity SoyBaseN/AISS
GO:0042578GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoric ester hydrolase activity SoyBaseN/AISS
PTHR11200Panther INOSITOL 5-PHOSPHATASE JGI ISS
PTHR11200:SF9Panther SYNAPTOJANIN-RELATED JGI ISS
PF02383PFAM SacI homology domain JGI ISS
UniRef100_B9S742UniRef Annotation by Michelle Graham. Most informative UniRef hit: Phosphoinositide 5-phosphatase, putative n=1 Tax=Ricinus communis RepID=B9S742_RICCO SoyBaseE_val: 9.00E-163ISS
UniRef100_I1KW89UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KW89_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma20g17320
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g17320 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma20g17320
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g17320
>Glyma20g17320.1   sequence type=CDS   gene model=Glyma20g17320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGGTACTTGAAAAGGGGTGTGAATGATCGGGGGAGGGTTGGTAATGATGTTGAGACAGAGCAGATTGTCCTTGATGAAGAATCAGGCTCTTGCAAGGGGAAGATGAGTTCAGTTGTGCAAATACGTGGATCAATAGCGCTTTTCTGGTCACAAGAAGCATCAACATTTAGCCCCAAGCCTGACATAATTTGTATGAAAACACTCTCTTTTAATGTCCCCCGCCCCCCCTGTTTTGACTTCCAGTGCAGAGGAGGTGTAGCTAGTGAAGCGCTTGATTTAACTGGGTTTTACTACAGTGGTAAAACCAACATCATTAAGAGAGCCAACAAGAGCAATAGAACAAGCACAGGGAGACTATTTTATTTTGATGGTGGTAAGGTAACAACACTTGTGGCTATTTCAGTAGAGGCTCTAATGAGAGCTAGAGCTAGTTCTGGGGATCTTGTGAGGATTGGGAACAGTAATGAAATGCTAAATTCTGTGGTTAATCAAGACAAAGAGACTGAAATGAACCATCAGAATAAAAAAGATAATAATTTAGTATATGCATATGGTCTTCAAGCTTTAGGACGCCAGCTCCATGCAATGGGTTTGACTGATGTTCCAAAAGTGGATCCTGATAGTAGTATTGCTGTAGCTCTACTGGATATGTATCAAAGTATGGGAGATGCTCTTGCTCAGCAATACGGTGGCTCTGATGCTCACAATACTGTGTTTCCAGAGAGGCAGGGAAAGTGGAAAGCAACAACACAATCAAGAGAGTTTTTAAAATCTATAAAACGATACTATAGCAATGCTTACACAGATGATGGAATTCATAGTTCATCTTTAGTAAGATTTTATATTTTTAGGTTTCTAATGTTTTTAGGTTACTTCCAACCACATGAAGGGAAACCTGCTCTCTGGGAGCTGGATTCAGATTATTATATCCATGAATCTGGGATTGGGGATGATCTAATTCCTGAGAAAGGTGGAATGGTATTCATGCCTATACCAGCTTGTAGAGATGACTTCTCTCGCATAAATAAAATAAAAAATGTAAGACTATGTTGTGAGCCTGATCAGAGACCAGGTGGGGTTTCTGGAAACAGTGGTGTAGCACCTGATGCAGCTGAGATACAGCTCAAAAGCCCAAATTGGCTTTTCGGCCAGAGAAAGTATGAAGAGGGTTCCTCTGCTGCAAAAGTTGCTTCTCGTGAATCTGACGTTGAAGGATCTCAAGCTAATGGCTTTTGTGACTTGAATTGGCTTTCCTCTGGCAATGATATGAATGAAGAGGATGTTTTCCAAAGGTACCTTACAATGACCTCAACAAATGAGGCCAACGGTTGGTATGGAGGTAGTCTCCTAGGCGATCAAGATGAAAGCAGTGAGATATATAAACATTATGCTGAGTTA
Predicted protein sequences of Glyma20g17320
>Glyma20g17320.1   sequence type=predicted peptide   gene model=Glyma20g17320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RYLKRGVNDRGRVGNDVETEQIVLDEESGSCKGKMSSVVQIRGSIALFWSQEASTFSPKPDIICMKTLSFNVPRPPCFDFQCRGGVASEALDLTGFYYSGKTNIIKRANKSNRTSTGRLFYFDGGKVTTLVAISVEALMRARASSGDLVRIGNSNEMLNSVVNQDKETEMNHQNKKDNNLVYAYGLQALGRQLHAMGLTDVPKVDPDSSIAVALLDMYQSMGDALAQQYGGSDAHNTVFPERQGKWKATTQSREFLKSIKRYYSNAYTDDGIHSSSLVRFYIFRFLMFLGYFQPHEGKPALWELDSDYYIHESGIGDDLIPEKGGMVFMPIPACRDDFSRINKIKNVRLCCEPDQRPGGVSGNSGVAPDAAEIQLKSPNWLFGQRKYEEGSSAAKVASRESDVEGSQANGFCDLNWLSSGNDMNEEDVFQRYLTMTSTNEANGWYGGSLLGDQDESSEIYKHYAEL






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo