Glyma20g16170 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g16170

Feature Type:	gene_model
Chromosome:	Gm20
Start:	22526132
stop:	22537106
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g16170

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G64550	AT	Annotation by Michelle Graham. TAIR10: general control non-repressible 3 \| chr1:23968850-23973369 FORWARD LENGTH=715	SoyBase	E_val: 0	ISS
GO:0006094	GO-bp	Annotation by Michelle Graham. GO Biological Process: gluconeogenesis	SoyBase	N/A	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006406	GO-bp	Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus	SoyBase	N/A	ISS
GO:0006606	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein import into nucleus	SoyBase	N/A	ISS
GO:0007010	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0010498	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
KOG0062	KOG	ATPase component of ABC transporters with duplicated ATPase domains/Translation elongation factor EF-3b	JGI		ISS
PTHR19211	Panther	ATP-BINDING TRANSPORT PROTEIN-RELATED	JGI		ISS
PTHR19211:SF18	Panther	gb def: abc transporter, atp-binding protein, ef-3 family [deinococcus radiodurans]	JGI		ISS
PF00005	PFAM	ABC transporter	JGI		ISS
UniRef100_G7J816	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter family protein n=1 Tax=Medicago truncatula RepID=G7J816_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1NEA8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NEA8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma20g16170

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma20g16170

Paralog	Evidence	Comments
Glyma13g10530	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma20g16170 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g066600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g16170

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g16170

Limit To All Plant Sequences

>Glyma20g16170.1   sequence type=CDS   gene model=Glyma20g16170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGGAGGTGGCGAGATCAGTGGTGCACGACGTTTTGGGGCAAAGAGTGGTCGACGTGGACCAGCCAATCGTCGATTATATCGTCAACGTCCTCGCCGACGATGACTTCGATTTCGGCCTCGACGGCGAAGGCGCCTTCGATGCCCTCGGCGAGCTCCTCGTCGCCGCCGACTGCGTCGACGATTTCTCCCACTGCCGCTCCGTATGCAGCACGCTGTGCGACAAGTTCGGGAAGCACGGTTTGGTGAAGGAGAAGCCCGCTGTGCGAAGCCTTGCGGCGCCGTTTCGAATGAACGAGGGAATGGACGACGTCCAAGCTCCCAAGAAGAAGCCCGAGCCCGTCGACGGCCCTCTTCTATCCGAACGCGATCGCTTAAAGCTCGAGCGGCGAAAACGCAAGGATGAACGCCAGCGAGAGGCACAATACCAAATACACTTGGCGGAGATGGAGGCAGCACGAGCGGGGATGCCGGTGGTGTGTGTGAGGCATGATAGCAGTGGGGGACCAAACGTGAAGGACATTCATATGGAGAATTTCAACATCTCTGTTGGTGGTCGTGATCTCATTGTGGATGGTTGTGTGACACTTTCATTTGGAAGGCATTATGGTTTGGTAGGAAGGAATGGGACGGGGAAAACCACTTTCCTTAGGCACATGGCTATGCATGCCATTGATGGTGTTCCAAGGAATTGCCAGATACTGCATGTGGAGCAAGAGGTGACAGGTGATGCTACGACTGCTTTGCAGTGTGTCCTCAATGCTGACATTGAGAGGACTCAGCTTCTCGATGAAGAAACTCAGTTAGTTGCCCAACAGAGGGAATTGGAGGACAAAAACGAAAAAGGTGATTTGAATGGAGTGGTCGGTAGGGATGACATTTCAAAAAGGCTTGAGGAAATATATAAGAGGCTTGAACTCATTGATGCTGATTCTGCCGAGGCACGAGCAGCATCAATACTAGCGGGTTTGAGTTTCACTCCTGAGATGCAGAAAAAGGCAACAAAAACATTTTCTGGAGGATGGCGGATGCGAATAGCTCTTGCTCGTGCATTGTTTATAGAGCCTGATATATTGCTTCTTGATGAGCCTACGAATCATCTTGATCTTCATGCTGTCTTATGGCTTGAATCTTACTTGGTTAAATGGCCAAAAACATTTATTGTTGTTTCTCATGCTAGAGAATTTTTAAACACGGTGGTTACTGATATAATTCACTTGCAAAACCAAAAGCTGACTACTTATAAAGGGAATTATGATACTTTTGAGAAGACTCGAGAAGAACAAGTTAAAAACCAGCAAAAAGCATTAGAGGCAAACGAACGTGCTAGATCTCATATGCAGACCTTCATTGACAAGTTCCGTTATAATGCGAAGAGGGCATCACTTGTTCAATCTAGAATCAAGGCTTTGGATCGAATGGGCCATGTGGATGAAATTGTTAATGATCCTGACTACAAATTTGACTTCCCCACTCCAGAAGATAGACCTGGTGCACCGATAATAAGTTTCAGTGATGCATCATTTGGTTATCCTGGGGGGCCCATTCTTTTTAAGAATTTGAACTTTGGGATTGATCTCGACAGTCGAATTGCAATGGTTGGACCCAATGGTATTGGCAAGTCAACTATACTTAAGTTAATTGCTGGGGATCTTCAGCCCAGTTCTGGGACTGTCTTCCGTTCTGCTAAGGTTCGTATAGCAGTGTTCAGTCAGCACCATGTTGATGGACTGGACTTATCCTCAAACCCTCTTCTGTATATGATGCGCTGCTATCCTGGAGTTCCAGAACAGAAGCTTCGAGCTCACTTAGGTTCTTTTGGTGTAACCGGAAATCTTGCACTGCAGCCAATGTATACTTTGTCAGGTGGTCAGAAAAGCAGGGTTGCCTTTGCAAAGATAACTTTCAAGAAGCCACACATAATATTGCTTGATGAACCATCCAATCATCTGGATTTGGATGCTGTTGAGGCGCTTATTCAAGGTCTTGTGCTGTTCCAAGGAGGCATTCTCATGGTGAGTCACGATGAGCATCTCATCTCTGGAAGCGTGGAGGAACTATGGGTTGTATCCGACGGAAGAGTGGCACCATTCCATGGCACATTCCAAGATTATAAGAAGATACTCCAATCATCTTAG

Predicted protein sequences of Glyma20g16170

Limit To All Plant Sequences

>Glyma20g16170.1   sequence type=predicted peptide   gene model=Glyma20g16170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEVARSVVHDVLGQRVVDVDQPIVDYIVNVLADDDFDFGLDGEGAFDALGELLVAADCVDDFSHCRSVCSTLCDKFGKHGLVKEKPAVRSLAAPFRMNEGMDDVQAPKKKPEPVDGPLLSERDRLKLERRKRKDERQREAQYQIHLAEMEAARAGMPVVCVRHDSSGGPNVKDIHMENFNISVGGRDLIVDGCVTLSFGRHYGLVGRNGTGKTTFLRHMAMHAIDGVPRNCQILHVEQEVTGDATTALQCVLNADIERTQLLDEETQLVAQQRELEDKNEKGDLNGVVGRDDISKRLEEIYKRLELIDADSAEARAASILAGLSFTPEMQKKATKTFSGGWRMRIALARALFIEPDILLLDEPTNHLDLHAVLWLESYLVKWPKTFIVVSHAREFLNTVVTDIIHLQNQKLTTYKGNYDTFEKTREEQVKNQQKALEANERARSHMQTFIDKFRYNAKRASLVQSRIKALDRMGHVDEIVNDPDYKFDFPTPEDRPGAPIISFSDASFGYPGGPILFKNLNFGIDLDSRIAMVGPNGIGKSTILKLIAGDLQPSSGTVFRSAKVRIAVFSQHHVDGLDLSSNPLLYMMRCYPGVPEQKLRAHLGSFGVTGNLALQPMYTLSGGQKSRVAFAKITFKKPHIILLDEPSNHLDLDAVEALIQGLVLFQGGILMVSHDEHLISGSVEELWVVSDGRVAPFHGTFQDYKKILQSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain