SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g15220

Feature Type:gene_model
Chromosome:Gm20
Start:20710341
stop:20714881
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g15220
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48190AT Annotation by Michelle Graham. TAIR10: ataxia-telangiectasia mutated | chr3:17797628-17828361 FORWARD LENGTH=3845 SoyBaseE_val: 1.00E-17ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006259GO-bp Annotation by Michelle Graham. GO Biological Process: DNA metabolic process SoyBaseN/AISS
GO:0006281GO-bp Annotation by Michelle Graham. GO Biological Process: DNA repair SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007059GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome segregation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010212GO-bp Annotation by Michelle Graham. GO Biological Process: response to ionizing radiation SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0000285GO-mf Annotation by Michelle Graham. GO Molecular Function: 1-phosphatidylinositol-3-phosphate 5-kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
GO:0016773GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor SoyBaseN/AISS
UniRef100_Q9M3G7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine-protein kinase ATM n=1 Tax=Arabidopsis thaliana RepID=ATM_ARATH SoyBaseE_val: 7.00E-15ISS
UniRef100_UPI000233DC72UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233DC72 related cluster n=1 Tax=unknown RepID=UPI000233DC72 SoyBaseE_val: 0ISS

Expression Patterns of Glyma20g15220
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g15220 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g064400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g15220
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g15220
>Glyma20g15220.2   sequence type=CDS   gene model=Glyma20g15220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGTGGTTTTGACCTTAGGAAGAGAAGACACTAATTCTGTTGATGAGACAAAAATGACTGAAGACACCATCTTGACTGAAGAAGCCCCGGAGAAGCTTGAAGGCTGCTTTGATTCTAGAGATCGAAGAAAAAGCAAGTACCTGTCTTACCCATACATTGGACCAAACCAAAAGGATCTGCCAGCTGAAACTGAAGATTTGAAGACACCATGTCCTTCTCAGAAAGCAAGGGCTTCAAGTGTCACTACTAATCCTCTAAATGGATCTTCTTCATATGCTAAATTGGGTAGCAAGAGGTTCCGAAATAGCTGGTACAAAAAATTCATCAGCTGTAATACTATGCCCAGCCATTACAATTTCATGAATGCATCTGCAGAAGAATTACTTTCAGGACTTTGTTCTACAGCTGTTGATTGTATGTTTCCAGTTGGGAATAAGAGCTTTGATTTAGTTGAGTGGTTCTTTTGCAGATATAGAGTATCAAATTATCATGATGAGGCTGAACTTGCTACTTCCCAGGTTAATGCAAAAGAAGAAAAATTGGGAAAACCTGAGGGTAATGATTTGCCAGATACCAAAAGTAAGAAGAGAAAGACCAATAGAATGGAAAATGCAGTTAGGCGTAAGAGAAAATCACTCTCTGGCCTATCAGATGTGAATGTAAACACTTCTAATGGTGACTCTCAAAGGCCTGGGAGAAAACTGAAACAAAAGAGGAAGGTGGAAGAAGTAACTTTAGTACATCAACTGCAAAATGTTGAGATAAATTTTATTGGGGTAAGCAGCAAATACAGCTCAGCTCCTCAAGCTGCACAAAATTTGTGTTGCCTTGCGTCTGAAGGAAAGTCTGAGCACAATCAGAGGGAAAAGATAGAGGCACAAGAACATCAAACTGCTCAAATTAATTCAGTGTATACAGATGCAAAAAAGCTTAACTGCAGTTCACTGGTAATAGATTTGCAGTTTACACCCCCAGCTATACCTGTTGATATTCCTGAGAGAAATAGAAGTGAAAATACGGAAGAAATAGTTTTATTAGCTTCAAATCCAGAGTCACGTGTTTCCCAAGAAGGACCTGTTGGGAGTATTACTGATCATAGCTTGTTGGTTAGTACTAAGGCTGAGGTTGGTACTGTCATGGTAAATAAAACAGGGTTGATGAATAGCATGGGGAAAGCAACAGGACTGCATCTCAATACTAAACTTGCTGTTGGAGTGCCTCTCAATAGCATGGGGAAAGCAGCAGCAGCAGGAGTGCATCTTAATGCTAAACTTGCTGTTGGAATGCCTCTCAATGGCATGGGGAAAGCAGCAGCAGGAGTGCATCTTAATACTAAACTTGCTGTAGAGAAAAAAGGGTTGAAGAATAGCATGGAAAAGCCAGCAGAAAAGCCTCTCTATACAAACTTTTCTACAGGGAAAACAGGGCTGAAGAATAGCATGGAGAAGGCAGCAGAAAAGCCTCTCTATACTAAAGTTGCTGTAGAGATACCTGATTTGAACGGTACTGGTGCTGAATGTAATTCGATCAGCACAGAATTTGATACTCTTAATTTCATTTCACCTGAATTAAAATCGGAGCAGTCCAAAAGCTTATCTGCATGTTCAAGATCTGCCAAAACTACTACTTGCAATAGACTGGATGACAGTGGAGAATCACTTGGAACCTGTGTTATCCTAAAATTTGCCCCTGTAGCCTATATCCCATCAAAAGAAGATTTAATGACAACATTTTGCCGGTTTGGTCCCTTGAAGGCATCTGAAACTCAGTTGTTAAAAGACACTGGTAGTGCTCAAGTTGTTTTTGTCAGAAGTGAAGATGCTGCAGCTGCATTTCATAGTATAGAGCAGAACAACAAATTTGCCTTTGGTTGTTCTCTTGTTGATTGCAAGCTCCATCATCTTTCTGCCACCTGTCCACCTGTTGAGCAACTTGTGACCACTGCCCAACCAACTGGGTTTATGGCAATACCTGGTGTGATGACCCCTACTCGACCAACCATGTCTATGGAAATGCCCGGTGTTACCCCTACCCAACCAGCTGGGTCTATAGCAACGCCTGGTGTGACACCAACCCAGCAGCCAACTGGGTCGAAGGCCGTGCCCGGTGTCACTCCTATCCTACCAACTGGGTCGATGACAATGCCTGGTGAGACACCTCCTTCCCTTCATTTCATTAAGCAGAACTTGCAGATGATGACATCAATCCTGGAGAATTCAGGGAGCAGTCTTTCCCCCAAGACGAGAGCCAAACTGGATTCTGAAATTAAAAACCTTATGAGAAAGGTGAATTCCAGGACCAAGGTCTGA
Predicted protein sequences of Glyma20g15220
>Glyma20g15220.2   sequence type=predicted peptide   gene model=Glyma20g15220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDVVLTLGREDTNSVDETKMTEDTILTEEAPEKLEGCFDSRDRRKSKYLSYPYIGPNQKDLPAETEDLKTPCPSQKARASSVTTNPLNGSSSYAKLGSKRFRNSWYKKFISCNTMPSHYNFMNASAEELLSGLCSTAVDCMFPVGNKSFDLVEWFFCRYRVSNYHDEAELATSQVNAKEEKLGKPEGNDLPDTKSKKRKTNRMENAVRRKRKSLSGLSDVNVNTSNGDSQRPGRKLKQKRKVEEVTLVHQLQNVEINFIGVSSKYSSAPQAAQNLCCLASEGKSEHNQREKIEAQEHQTAQINSVYTDAKKLNCSSLVIDLQFTPPAIPVDIPERNRSENTEEIVLLASNPESRVSQEGPVGSITDHSLLVSTKAEVGTVMVNKTGLMNSMGKATGLHLNTKLAVGVPLNSMGKAAAAGVHLNAKLAVGMPLNGMGKAAAGVHLNTKLAVEKKGLKNSMEKPAEKPLYTNFSTGKTGLKNSMEKAAEKPLYTKVAVEIPDLNGTGAECNSISTEFDTLNFISPELKSEQSKSLSACSRSAKTTTCNRLDDSGESLGTCVILKFAPVAYIPSKEDLMTTFCRFGPLKASETQLLKDTGSAQVVFVRSEDAAAAFHSIEQNNKFAFGCSLVDCKLHHLSATCPPVEQLVTTAQPTGFMAIPGVMTPTRPTMSMEMPGVTPTQPAGSIATPGVTPTQQPTGSKAVPGVTPILPTGSMTMPGETPPSLHFIKQNLQMMTSILENSGSSLSPKTRAKLDSEIKNLMRKVNSRTKV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo