Glyma20g12030 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma20g12030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma20g12030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma20g12030

Feature Type:	gene_model
Chromosome:	Gm20
Start:	16913798
stop:	16914972
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma20g12030

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G37660	AT	Annotation by Michelle Graham. TAIR10: Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein \| chr4:17695543-17696046 FORWARD LENGTH=167	SoyBase	E_val: 1.00E-41	ISS
GO:0006354	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation	SoyBase	N/A	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0015934	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: large ribosomal subunit	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
KOG1715	KOG	Mitochondrial/chloroplast ribosomal protein L12	JGI		ISS
PTHR11809	Panther	RIBOSOMAL PROTEIN L7/L12	JGI		ISS
PTHR11809:SF6	Panther	gb def: ribosomal protein [arabidopsis thaliana]	JGI		ISS
PF00542	PFAM	Ribosomal protein L7/L12 C-terminal domain	JGI		ISS
UniRef100_D7MA23	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein L12 family protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MA23_ARALL	SoyBase	E_val: 2.00E-44	ISS
UniRef100_I1NE55	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NE55_SOYBN	SoyBase	E_val: 4.00E-109	ISS

Expression Patterns of Glyma20g12030

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma20g12030 not represented in the dataset	Glyma20g12030 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g12030 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.20g052800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma20g12030

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma20g12030

Limit To All Plant Sequences

>Glyma20g12030.1   sequence type=CDS   gene model=Glyma20g12030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCGCTGTGCCCCGAGGTGTGTAACAAAGAGTGCCACGAGGCTTTTCAACCTCACACGCGCTCTCTCCATTGAGGCGCGCGAGCAGAAGGTCGAGCGCATCGCCACCGAGCTTCTCAACCTCAACAGGTTCGAGAGGCACGACTTCACGGTCCTCTGGCGGCTCAAGATGGGTCTACACCGCTATGACGCCGCCCCGGTGGCCGGCGTTGCGACGCCGTCCGTCGTCGGCGCGAAGGTCGGTGCTTCCGTGGCGGTGGAGAAGACGGCGTTTGATTTGAAGTTGGAGAAGTATGATGCTGCTGCCAAGATCAAGATCATCAAAGAAGTTAGGTCTTTCACTGATTTAGGGTTGAAGGAAGCCAAGGAATTGGTGGAGAAGGTTCCTTGTGTTTTGAAGAAGGGGCTCACCAAGGAGGAGGCTAATCCCATCATGGAGAAACTCAAGGAGTTGGGCGCTGCTGTTGTGTTGGAGTGA

Predicted protein sequences of Glyma20g12030

Limit To All Plant Sequences

>Glyma20g12030.1   sequence type=predicted peptide   gene model=Glyma20g12030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRCAPRCVTKSATRLFNLTRALSIEAREQKVERIATELLNLNRFERHDFTVLWRLKMGLHRYDAAPVAGVATPSVVGAKVGASVAVEKTAFDLKLEKYDAAAKIKIIKEVRSFTDLGLKEAKELVEKVPCVLKKGLTKEEANPIMEKLKELGAAVVLE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain