|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G13940 | AT | Annotation by Michelle Graham. TAIR10: S-adenosyl-L-homocysteine hydrolase | chr4:8054931-8056763 FORWARD LENGTH=325 | SoyBase | E_val: 2.00E-38 | ISS |
| GO:0006094 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gluconeogenesis | SoyBase | N/A | ISS |
| GO:0006096 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glycolysis | SoyBase | N/A | ISS |
| GO:0006346 | GO-bp | Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing | SoyBase | N/A | ISS |
| GO:0006511 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process | SoyBase | N/A | ISS |
| GO:0006730 | GO-bp | Annotation by Michelle Graham. GO Biological Process: one-carbon metabolic process | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0006972 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hyperosmotic response | SoyBase | N/A | ISS |
| GO:0007030 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi organization | SoyBase | N/A | ISS |
| GO:0009266 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0009793 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy | SoyBase | N/A | ISS |
| GO:0009853 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photorespiration | SoyBase | N/A | ISS |
| GO:0016441 | GO-bp | Annotation by Michelle Graham. GO Biological Process: posttranscriptional gene silencing | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0048767 | GO-bp | Annotation by Michelle Graham. GO Biological Process: root hair elongation | SoyBase | N/A | ISS |
| GO:0051049 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transport | SoyBase | N/A | ISS |
| GO:0051788 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to misfolded protein | SoyBase | N/A | ISS |
| GO:0080129 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005773 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuole | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0048046 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: apoplast | SoyBase | N/A | ISS |
| GO:0000166 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: nucleotide binding | SoyBase | N/A | ISS |
| GO:0004013 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: adenosylhomocysteinase activity | SoyBase | N/A | ISS |
| GO:0005507 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: copper ion binding | SoyBase | N/A | ISS |
| PF05221 | PFAM | S-adenosyl-L-homocysteine hydrolase | JGI | ISS | |
| UniRef100_I1KS65 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Adenosylhomocysteinase n=1 Tax=Glycine max RepID=I1KS65_SOYBN | SoyBase | E_val: 6.00E-40 | ISS |
| UniRef100_I1KS65 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Adenosylhomocysteinase n=1 Tax=Glycine max RepID=I1KS65_SOYBN | SoyBase | E_val: 6.00E-40 | ISS |
|
Glyma20g11150 not represented in the dataset |
Glyma20g11150 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.20g047200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma20g11150.1 sequence type=CDS gene model=Glyma20g11150 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCTTTTTTGGTGGAGAAAACCACACAAGTGGTCACGAGTACAAGGTCAATGACCTTTTGTAGGGCCACACCGATGCTCCTGCAGCATCTTCTCCACCCAAGACCACGCCGCTGCCACTATTGCACCGAGCGTGCCCTCGACTGGGTCCCCGGCGGAGGACCCAACCTCATCGTCGATCATGGTGATGACGCTACCCTCCTCATCCATGAAGGCGTCAAGGCCGAGGAACTTTATGAGAAGACCAAGGAACTCCTCGACCCCAACTCCACTGACAACGCCGAGTTCCAGATCGTGCTTACCATCATCAGAGATGGGCTCTATCAAATGCAACCGAATGGCACTCTTCTCTTCCCTGCTATTAATGTGACTGACTTTGTCACCAACAACAAGGTAATGTCTCTTTTTCCCCCAGATATAGTGCCTTTTGTGTTAAAATTGAAATGGGGTTTTGAACCTTTCAATTGCTTGACTAATATGACTGATTATGATGAGTATGGCACACCTCTGGATCGAGAAACATTTATGAAAGAGCTTGAGACTTTTTACAGACACCACTCAATTGTCTTAAGTACGTATAATATCCCTTGTGATGCATTCATGGAATTTAAGCCTCCTAAGTTTTACACTGTAGTTGTGCTTTCAGTAGTGTTTATATACTCAAGAGCTACACAAACGATTGCAGACACTAGCTGTAGGCTATAG
>Glyma20g11150.1 sequence type=predicted peptide gene model=Glyma20g11150 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MAFLVEKTTQVVTSTRSMTFCRATPMLLQHLLHPRPRRCHYCTERALDWVPGGGPNLIVDHGDDATLLIHEGVKAEELYEKTKELLDPNSTDNAEFQIVLTIIRDGLYQMQPNGTLLFPAINVTDFVTNNKVMSLFPPDIVPFVLKLKWGFEPFNCLTNMTDYDEYGTPLDRETFMKELETFYRHHSIVLSTYNIPCDAFMEFKPPKFYTVVVLSVVFIYSRATQTIADTSCRL*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||